ID: 908257260

View in Genome Browser
Species Human (GRCh38)
Location 1:62313293-62313315
Sequence TACTACTGTACTGCATTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908257258_908257260 -7 Left 908257258 1:62313277-62313299 CCCATGGGAAAGGAGGTACTACT 0: 1
1: 0
2: 1
3: 20
4: 180
Right 908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG 0: 1
1: 0
2: 0
3: 22
4: 163
908257255_908257260 7 Left 908257255 1:62313263-62313285 CCTGGAATGTATCTCCCATGGGA No data
Right 908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG 0: 1
1: 0
2: 0
3: 22
4: 163
908257252_908257260 18 Left 908257252 1:62313252-62313274 CCACAGAGGGTCCTGGAATGTAT 0: 1
1: 2
2: 24
3: 204
4: 551
Right 908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG 0: 1
1: 0
2: 0
3: 22
4: 163
908257259_908257260 -8 Left 908257259 1:62313278-62313300 CCATGGGAAAGGAGGTACTACTG No data
Right 908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG 0: 1
1: 0
2: 0
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908257260 Original CRISPR TACTACTGTACTGCATTTTA TGG Intronic
902245499 1:15118029-15118051 TACTACTGCACAGCACTTTATGG + Exonic
905696968 1:39981669-39981691 CACTACTGTACTCCAGCTTAGGG - Intergenic
908207289 1:61863886-61863908 TACTTATGTACTACTTTTTATGG + Intronic
908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG + Intronic
909266754 1:73569670-73569692 TATTACTGTACTGAATATTGTGG - Intergenic
910641812 1:89472299-89472321 TCCTACTGTAGTGCCCTTTAGGG - Intergenic
911548402 1:99250094-99250116 TATTACTTCACTGTATTTTATGG + Intergenic
911660701 1:100498449-100498471 TACAACTGAACTCCATTTTCTGG - Intronic
916600906 1:166292767-166292789 GATTCCTGAACTGCATTTTAAGG - Intergenic
917482943 1:175427964-175427986 TTCTGCTGTAATGCATTTTTTGG - Intronic
917734325 1:177906826-177906848 TACTACTTTTCTTCCTTTTATGG + Intergenic
917924554 1:179778389-179778411 TACTTGTGAACAGCATTTTATGG + Intronic
919618194 1:199833919-199833941 TAATACTGCATTCCATTTTATGG + Intergenic
920256546 1:204659136-204659158 TCATACTTTACTGCATTTTATGG + Intronic
921303914 1:213776892-213776914 TCATACTGTACTTTATTTTATGG + Intergenic
1063262705 10:4408276-4408298 TAGTACTTTAATGCATTTTTTGG + Intergenic
1063990882 10:11561573-11561595 TACTATTGTACTTCACTATATGG + Intronic
1065066212 10:21967818-21967840 TACTCATGTATTGCTTTTTAAGG + Intronic
1074351815 10:112745044-112745066 TACTTTTTTCCTGCATTTTATGG - Intronic
1074594126 10:114844583-114844605 TATGACTGTATTGCATTTTAGGG + Intronic
1074736921 10:116445059-116445081 TTTTACTACACTGCATTTTAGGG - Intronic
1077843831 11:6003028-6003050 TACTTCTCTACTACGTTTTAAGG - Exonic
1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG + Intronic
1080523260 11:33087141-33087163 TTCTTCTGTTCTGCATTTTCAGG - Exonic
1085976756 11:81664727-81664749 TAGTATTGTATTCCATTTTATGG + Intergenic
1087317154 11:96615725-96615747 TACTACTTTACTGAATATTTAGG - Intergenic
1091246294 11:134098235-134098257 TACAAATGGACTGCTTTTTAGGG + Intronic
1093274461 12:17107046-17107068 AGCTTCTGTGCTGCATTTTATGG - Intergenic
1093472725 12:19522329-19522351 TACTACTATAAAACATTTTAAGG - Intronic
1093842050 12:23915749-23915771 TCCTACTGTCCTTGATTTTAAGG - Intronic
1094215501 12:27937020-27937042 TAATACTTCATTGCATTTTATGG - Intergenic
1096439403 12:51627308-51627330 TACAATTGTATTGCACTTTAAGG - Intronic
1097847285 12:64379687-64379709 GACTACTTTATAGCATTTTAAGG - Intronic
1098080441 12:66779407-66779429 TTACACTTTACTGCATTTTATGG + Intronic
1099107350 12:78512723-78512745 TTCTTTTTTACTGCATTTTATGG - Intergenic
1099485153 12:83220554-83220576 AATTAGTGTACTGTATTTTAGGG - Intergenic
1099930790 12:89071982-89072004 TCCTACTTTGCTGTATTTTATGG - Intergenic
1100401687 12:94236089-94236111 TTATACTTGACTGCATTTTATGG - Intronic
1101183208 12:102242666-102242688 TAAAACTGTATTGCATTTTGAGG + Intergenic
1105453755 13:20522682-20522704 TTCTCCTGTCCTGCTTTTTAGGG - Intronic
1105633284 13:22193141-22193163 CACTACTCTACTGCATTTGTTGG + Intergenic
1107093082 13:36504253-36504275 AACTGGTGTACTGCAATTTAAGG + Intergenic
1109782913 13:67136190-67136212 TGTTACTGTACTGAATTCTATGG - Intronic
1111826332 13:93272933-93272955 TACCACCTTACTGCATTTTATGG - Intronic
1112523956 13:100125423-100125445 GACTGCAGTACTGCATTTAATGG + Intronic
1114161693 14:20175286-20175308 TTCTACTGTACTGAACTTTGGGG + Intergenic
1114908527 14:27162556-27162578 TAGCACTTTACTGCTTTTTACGG + Intergenic
1115732569 14:36287224-36287246 TACTTCTTTACTGCAGTTCATGG + Intergenic
1120349303 14:83331970-83331992 TATTACTTTACTGTATTTTAGGG - Intergenic
1120608751 14:86612487-86612509 TATTACTGAACTCCATTGTATGG - Intergenic
1120637267 14:86967648-86967670 TACTACTGTATTTCACATTAGGG - Intergenic
1121730944 14:96186719-96186741 TACCACTGTCCTGCTTTTGAGGG - Intergenic
1122492330 14:102126939-102126961 TACTACTTTACAGCAATCTATGG + Intronic
1124421306 15:29525398-29525420 TAATACTTTATTTCATTTTATGG - Intronic
1124807513 15:32900618-32900640 AACTACAATAATGCATTTTAAGG + Intronic
1127678397 15:61268075-61268097 TACTACTGTATTCTATTCTATGG - Intergenic
1129482694 15:75840634-75840656 AACTACTGAACTACATTTCAGGG - Intergenic
1137462827 16:48680902-48680924 TGCTTCTTTCCTGCATTTTAAGG - Intergenic
1138626023 16:58252455-58252477 TACTAGTGTTCTGAATTTTGTGG + Intronic
1138951916 16:61922236-61922258 CAATACTGTAGTGCACTTTAAGG + Intronic
1145314910 17:21724142-21724164 TATTGCTGTGCTGTATTTTATGG - Intergenic
1146020147 17:29271052-29271074 TACTTCTTTACTGCAGCTTAAGG + Intronic
1146552257 17:33791484-33791506 GGCTACTGTACTGAATTTTTTGG - Intronic
1149816403 17:59729101-59729123 TACTACTTTATTTCTTTTTATGG + Intronic
1151686725 17:75651698-75651720 GACTACTGAACTGAATTTTCTGG + Intronic
1153357566 18:4154564-4154586 TACAAAGGTATTGCATTTTATGG + Intronic
1153602315 18:6793196-6793218 TACAATTGTACAGCATTTTAGGG - Intronic
1155059833 18:22218836-22218858 AACTACTCTACAGTATTTTATGG + Intergenic
1155392879 18:25354075-25354097 TAGTACTGCATAGCATTTTAAGG + Intergenic
1155851864 18:30783986-30784008 TACTTCTTTACTTCAGTTTAGGG - Intergenic
1157851899 18:51062440-51062462 AGCTACTGTCCTGCTTTTTATGG + Intronic
1159892821 18:73968605-73968627 TTCTAGTGTCCTGCATTTTATGG - Intergenic
1160385743 18:78495244-78495266 CACTACTGTAGGGCAGTTTACGG + Intergenic
1162691478 19:12437005-12437027 TAACACTGTACTGGCTTTTAGGG - Intronic
930080011 2:47438521-47438543 TACTAATGTACTGTTATTTAGGG - Intronic
930974007 2:57432182-57432204 TACTATTTTACTGCATTGCAGGG - Intergenic
932916567 2:75865539-75865561 TACATCTGTGCAGCATTTTATGG + Intergenic
933484807 2:82906634-82906656 TACTAATATACTTCATTTTCTGG - Intergenic
933690271 2:85174332-85174354 AAATACTGTACTGCATTATATGG + Intronic
934625348 2:95844654-95844676 TAATACTGAACTTCTTTTTAAGG + Intronic
934808222 2:97256644-97256666 TAATACTGAACTTCTTTTTAAGG - Intronic
934829287 2:97500542-97500564 TAATACTGAACTTCTTTTTAAGG + Intronic
939673066 2:145037714-145037736 TATTACTTTCCTGAATTTTAGGG - Intergenic
940429847 2:153576343-153576365 TCCTTCTGTACTGCCTTTCAAGG + Intergenic
940695247 2:156968719-156968741 TACTACTATACCGCATTAAAAGG - Intergenic
940935764 2:159493000-159493022 TACTAGTTTACTGTATTTTGAGG - Intronic
941790384 2:169546334-169546356 TGCTACTTTACAGCATTTCATGG - Exonic
942044619 2:172092933-172092955 GCCTTCTGTACTGCATTTGATGG - Intergenic
944000403 2:194828516-194828538 TGCTATAATACTGCATTTTATGG - Intergenic
945166168 2:206949100-206949122 AACCACTGTACTGCATATAATGG - Intronic
946459175 2:219853827-219853849 TCATACTCTACTGCATTTTATGG - Intergenic
1174603335 20:51742281-51742303 TGCCACTGTACTGCAGTCTAGGG + Intronic
1175655601 20:60767347-60767369 TGAACCTGTACTGCATTTTAAGG + Intergenic
1176348637 21:5772211-5772233 TACTATTGTAGTAGATTTTATGG + Intergenic
1176355451 21:5892795-5892817 TACTATTGTAGTAGATTTTATGG + Intergenic
1176496190 21:7552244-7552266 TACTATTGTAGTAGATTTTATGG - Intergenic
1176542958 21:8170281-8170303 TACTATTGTAGTAGATTTTATGG + Intergenic
1176561909 21:8353326-8353348 TACTATTGTAGTAGATTTTATGG + Intergenic
1176691824 21:9921404-9921426 TACTATTATACATCATTTTATGG + Intergenic
1177244498 21:18505069-18505091 TACTACTTCACTGAATTTTCAGG + Intergenic
1182641223 22:31769303-31769325 AACTACTATAGTGCATTTTGTGG - Intronic
1182848098 22:33447896-33447918 TAGTACTGTGCTCCTTTTTATGG - Intronic
1184322808 22:43756025-43756047 TGCTACTATATTTCATTTTATGG - Intronic
1203247827 22_KI270733v1_random:86530-86552 TACTATTGTAGTAGATTTTATGG + Intergenic
952780188 3:37089260-37089282 TAATATTTTACTGCATTTTCTGG + Intronic
952930032 3:38352765-38352787 TACCACTGTACTCCAGTTTGAGG + Intronic
953890415 3:46748216-46748238 TACTCCTGTTCTTCAGTTTATGG - Intronic
954852230 3:53613001-53613023 TCCTACAGAACTGCATTTTTCGG - Intronic
955224701 3:57051104-57051126 TACTTATGTACTGGATTTTGGGG - Intronic
955469107 3:59267790-59267812 GACTATTGTACTGCAGTTTAAGG + Intergenic
959356541 3:105337471-105337493 TACTACTGTAATTCTTTCTAAGG - Intergenic
959761593 3:109972251-109972273 TATTCCTTTAGTGCATTTTATGG - Intergenic
963493940 3:146036431-146036453 TATTACTGTACTGAATACTATGG - Intergenic
964422467 3:156518653-156518675 TAGTACTGAACTGCAATTGAAGG + Intronic
966544576 3:181131426-181131448 AACTTTTGTCCTGCATTTTATGG + Intergenic
967335695 3:188342000-188342022 TTCTACTCCATTGCATTTTATGG - Intronic
969919667 4:10525474-10525496 TACTTCTGAACAGCAATTTATGG - Intronic
972094042 4:35325997-35326019 TACCAATGTACTAAATTTTAAGG - Intergenic
978495273 4:109352659-109352681 TACTACTGTATTAGATTTTCTGG + Intergenic
979882252 4:125975679-125975701 TACTACTGTACTGGATAATAAGG - Intergenic
980364554 4:131783929-131783951 TACTAATGTACTTCTTTTTTAGG - Intergenic
981973443 4:150693659-150693681 AACCACTGTTCTGAATTTTATGG - Intronic
982031269 4:151303383-151303405 TATTACAGTAATTCATTTTAGGG + Intronic
982418738 4:155168197-155168219 TACAACTATACAGCATTTTGTGG + Intergenic
982828875 4:160034889-160034911 TTCTACTGTATTGCATATTTTGG + Intergenic
986565695 5:9111539-9111561 GTCTACTGAGCTGCATTTTAAGG + Intronic
986608154 5:9544272-9544294 TAATACCGTTCTGCTTTTTAGGG - Intronic
987790131 5:22554619-22554641 TCATACTGTGCTGCATTTAATGG - Intronic
988075505 5:26348790-26348812 TACAAATCTACTGCATTTTAAGG - Intergenic
988689130 5:33554749-33554771 TATGGCAGTACTGCATTTTATGG - Intronic
989084299 5:37658639-37658661 TACTCCTGTACTCCATTGTGAGG + Intronic
993963285 5:94328172-94328194 TATTACTGCACTGCATTTAAAGG + Intronic
994600481 5:101896594-101896616 TACAATTTTAGTGCATTTTATGG + Intergenic
996528566 5:124503129-124503151 TACCAGTGTACTTCATTTTAAGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007141460 6:39578715-39578737 GATCACTGTACTGCATTTAAGGG + Intronic
1010930507 6:81796356-81796378 TATTACTGTACTAGATTTTAAGG + Intergenic
1012007452 6:93731533-93731555 TGTTACTGTACTGAATTTTATGG + Intergenic
1012538292 6:100326741-100326763 TGCTGCTGTACTGCATTTTCAGG + Intergenic
1012828456 6:104177387-104177409 TACTGTTGTATTGCATTTTATGG - Intergenic
1014352301 6:120360509-120360531 GGCTACTGTACTGCTATTTAGGG - Intergenic
1020331215 7:7018804-7018826 TATTACTATACTGTATATTAAGG + Intergenic
1021850661 7:24805150-24805172 TATTACTGAACTGCCCTTTATGG + Intronic
1023745732 7:43320878-43320900 TACTACTGAACATCTTTTTAAGG - Intronic
1030291512 7:107877657-107877679 AACTACTTTAATCCATTTTATGG + Intergenic
1030884877 7:114923983-114924005 TACTAATGTAGTGAATCTTAGGG + Intronic
1032746738 7:134793692-134793714 CACTTCGGGACTGCATTTTAGGG - Intronic
1034990445 7:155544635-155544657 CAGGACTGTACTGGATTTTATGG + Intergenic
1037102637 8:15065849-15065871 TATTACTGCACTTCATATTAAGG - Intronic
1037201711 8:16261561-16261583 TACCATTGTACTTCATTTTCAGG - Intronic
1038879213 8:31589096-31589118 TACTACTGTAGTTCATTTTGTGG + Intergenic
1047425816 8:124745602-124745624 TACTACTTTATTCCTTTTTATGG - Intergenic
1047664403 8:127074906-127074928 TCCTACTGTATTATATTTTAAGG - Intergenic
1048808252 8:138261007-138261029 TTCTACTTTACTGCTTTTTATGG + Intronic
1050451354 9:5784843-5784865 TAGTACAGTACTGCATATTCAGG - Exonic
1050842818 9:10173928-10173950 TACTTATGTACTGAATTTTGAGG + Intronic
1050849552 9:10266198-10266220 AGCAACTGTAATGCATTTTAAGG - Intronic
1051290030 9:15535941-15535963 TATTACTTTAATACATTTTAAGG + Intergenic
1052488840 9:29137066-29137088 TACTACAGTACTGCATCTTTGGG - Intergenic
1053026900 9:34737368-34737390 TACTACTTTATTTCTTTTTATGG + Intergenic
1053628759 9:39907497-39907519 TACTATTATACATCATTTTATGG + Intergenic
1053777111 9:41556231-41556253 TACTAATGTACTTCTTTTTTAGG + Intergenic
1053777305 9:41558847-41558869 TACTATTATACATCATTTTATGG - Intergenic
1054215128 9:62343205-62343227 TACTATTATACATCATTTTATGG - Intergenic
1054364427 9:64319639-64319661 TACTATTATACATCATTTTATGG + Intergenic
1054364620 9:64322253-64322275 TACTAATGTACTTCTTTTTTAGG - Intergenic
1054672353 9:67812144-67812166 TACTATTATACATCATTTTATGG + Intergenic
1055035105 9:71810208-71810230 TACTACTCTACTTTATATTAGGG + Intronic
1056223162 9:84469662-84469684 TATTACTGTTTTGCATTATAAGG - Intergenic
1057640366 9:96814130-96814152 TACAGCTGTATTGCATTATATGG + Intergenic
1058300569 9:103366904-103366926 TACTCCTATACTGCTTCTTAAGG + Intergenic
1058791080 9:108446198-108446220 TTATACTGAACTGCATTTCAGGG + Intergenic
1059368193 9:113803728-113803750 CAGTACTTTATTGCATTTTATGG - Intergenic
1061698436 9:132395989-132396011 TACCACTGAACTGCATTTAAGGG + Intronic
1203464228 Un_GL000220v1:69765-69787 TACTATTGTAGTAGATTTTATGG + Intergenic
1203671230 Un_KI270755v1:13594-13616 TACTACAGAACTGCATATCAGGG - Intergenic
1188287566 X:28346564-28346586 TAATAATGTAGTTCATTTTAAGG + Intergenic
1189400080 X:40659471-40659493 TTCCACTGTCCTGCATTTTCAGG + Exonic
1189652314 X:43203601-43203623 AACAGCTGTACTGCATTGTAAGG + Intergenic
1191956066 X:66643568-66643590 TATTTCTCTACAGCATTTTATGG + Intergenic
1193100946 X:77611406-77611428 TAGTAGTGTTCTGCATTTAATGG + Intronic
1195527251 X:105905563-105905585 TATTACTGTACTGCCATTAATGG + Intronic
1198301251 X:135335889-135335911 TACCACTATCCTGAATTTTATGG + Intronic
1198923256 X:141755234-141755256 AACTACTATTCTGCATATTATGG + Intergenic
1199754110 X:150848678-150848700 GATTACTTTGCTGCATTTTAGGG - Intronic
1200018782 X:153184689-153184711 AAATACTTTACTGAATTTTATGG + Intergenic