ID: 908258027

View in Genome Browser
Species Human (GRCh38)
Location 1:62318657-62318679
Sequence GACTGGGCGTTCTTTGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258027_908258038 23 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
908258027_908258036 14 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258027_908258041 27 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258027_908258043 29 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258027_908258039 24 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
908258027_908258042 28 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258027_908258044 30 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258027 Original CRISPR GACTGGGCGTTCTTTGCCGC GGG (reversed) Intronic
902849400 1:19141777-19141799 GACTGGGGTTTCTTTGACTCAGG - Exonic
904871860 1:33624353-33624375 GACTGAGCCTCCTTAGCCGCAGG + Intronic
908258027 1:62318657-62318679 GACTGGGCGTTCTTTGCCGCGGG - Intronic
1071591005 10:86873213-86873235 GACTGTGAGTTCCTTGCAGCAGG + Intronic
1075010598 10:118866448-118866470 GACTGGAAGTCCTTTGCAGCTGG + Intergenic
1075471087 10:122690061-122690083 GTCAGGTCGTTCTTTGTCGCAGG + Intergenic
1084764989 11:71302339-71302361 CACTGGGCGTTCTTGGCGCCTGG - Intergenic
1094199464 12:27781005-27781027 GACTGAGCGTTGGTTCCCGCTGG + Exonic
1097761713 12:63473486-63473508 GACTTGGTTTTCTTTGCCTCTGG + Intergenic
1106662472 13:31814443-31814465 GACTGGGGGTGCTGTGCAGCTGG - Intergenic
1111128409 13:83942176-83942198 CACTGGGAGTTCTTTGTCTCAGG - Intergenic
1202837213 14_GL000009v2_random:87149-87171 GACTGGGCCTTCTGTGGCCCTGG + Intergenic
1202906605 14_GL000194v1_random:77279-77301 GACTGGGCCTTCTGTGGCCCTGG + Intergenic
1129359025 15:75012856-75012878 GACTGGGCGTGCTGGGCAGCGGG + Intronic
1141031485 16:80592640-80592662 GACTTGGCGTACTTTCCCCCAGG - Intergenic
1142867942 17:2802246-2802268 GACTGGCCGTACTTTGCCCAGGG - Intronic
1145748375 17:27337497-27337519 GATTGGGCGGTCTTTGCCTAGGG + Intergenic
1149569446 17:57662028-57662050 GACTAGGCTGACTTTGCCGCCGG - Intronic
1160683812 19:424338-424360 GACTGGGCGTTCCTTCAAGCAGG + Intronic
1162568254 19:11456066-11456088 GACTGGGGGGTCTCTGCTGCTGG + Intronic
1163202778 19:15780364-15780386 TGCTGGGAGTTCTTTGCCTCTGG + Intergenic
1202635426 1_KI270706v1_random:40202-40224 GACTGGGCCTTCTGTGGCCCTGG - Intergenic
925361517 2:3283575-3283597 GTCTGGGCGTCCTTTGCAGCTGG - Intronic
948143241 2:235690038-235690060 GACTGGGAGTTCTAAGCCCCTGG + Intronic
948941990 2:241201358-241201380 GAGTGGGGGTTCCCTGCCGCGGG + Intronic
1169171200 20:3467251-3467273 GCCTGGGTATTCTTTGCCACTGG + Intergenic
1172672765 20:36645740-36645762 GACTGGGCTTTATTTGCTGTTGG - Intronic
1176025285 20:62982430-62982452 GACTGGGCGTCCTTCTCTGCTGG + Intergenic
1176625951 21:9092078-9092100 GACTGGGCCTTCTGTGGCCCTGG + Intergenic
1183349055 22:37324678-37324700 GTCTGGGAGTTCATTTCCGCCGG - Intergenic
962356057 3:134695147-134695169 GACTGGGCTCTCTGTGCTGCGGG + Intronic
970008192 4:11429542-11429564 GACAGGGCGCTCTTTGAAGCCGG - Exonic
978739525 4:112121121-112121143 GACAGGGTGTTCTTTGCCCAGGG - Intergenic
983136861 4:164094726-164094748 GACTAGGTGTTGTTTGCCACTGG + Intronic
983289581 4:165785030-165785052 CACTGGGATTTCTTTGCCACAGG + Intergenic
1202762735 4_GL000008v2_random:126081-126103 GACTGGGCCTTCTGTGGCCCTGG - Intergenic
986145023 5:5070048-5070070 GACGGGGGTTTCTTTGCCTCTGG - Intergenic
988255068 5:28809778-28809800 GCCTGGGTGTTCTCTGCCCCCGG + Intergenic
998299218 5:141002066-141002088 GACTGCTCGTTCTTTGGCGCTGG - Intronic
1000454286 5:161429917-161429939 CACTGGGCCTTCTTTCCCACAGG - Intronic
1002455783 5:179344901-179344923 GACTCTGCGCTCTTGGCCGCGGG + Intronic
1020461376 7:8433590-8433612 GACTGGGCGACCTTGGCCTCTGG - Intergenic
1034532916 7:151707850-151707872 GCCTGGGCTTTCTTTGGCCCCGG - Intronic
1049499674 8:142955195-142955217 GCCTGAGCCTCCTTTGCCGCAGG + Intergenic
1060554697 9:124502191-124502213 GCCTAGGCGTTCATTGCCGCAGG - Intronic
1203749124 Un_GL000218v1:62499-62521 GACTGGGCCTTCTGTGGCCCTGG + Intergenic
1203543498 Un_KI270743v1:110962-110984 GACTGGGCCTTCTGTGGCCCTGG - Intergenic
1187136228 X:16550294-16550316 GAGTGGGGCTTCTTTGCGGCAGG - Intergenic
1190962317 X:55264714-55264736 GACTGTGGTTTCTGTGCCGCAGG + Exonic
1195505040 X:105646969-105646991 GACTTGGGGTTCTTGGCCTCAGG + Intronic
1201162481 Y:11177512-11177534 GACTGGGCCTTCTGTGGCCCTGG + Intergenic