ID: 908258028

View in Genome Browser
Species Human (GRCh38)
Location 1:62318658-62318680
Sequence GGACTGGGCGTTCTTTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258028_908258036 13 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258028_908258044 29 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258028_908258038 22 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
908258028_908258042 27 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258028_908258043 28 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258028_908258041 26 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258028_908258039 23 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258028 Original CRISPR GGACTGGGCGTTCTTTGCCG CGG (reversed) Intronic
900268701 1:1775442-1775464 GCACTGGGCATTATTTACCGGGG - Intronic
902249590 1:15145437-15145459 GGGCTGGGAATTCTTTGTCGTGG - Intergenic
902583305 1:17422977-17422999 GGCCGGGGCGTTCTTTGCTCTGG - Intronic
906517633 1:46448826-46448848 GGGCTGGGCGTAGTTTGCAGAGG + Intergenic
908258028 1:62318658-62318680 GGACTGGGCGTTCTTTGCCGCGG - Intronic
910163690 1:84300061-84300083 GGACTGGGAGTTCTGTGTCTTGG - Intronic
1065579183 10:27154455-27154477 TGCCTGCGCGTTCTTTCCCGCGG + Intronic
1067779648 10:49190488-49190510 GAACTGGGCGTTCATTACAGGGG - Intergenic
1073758196 10:106603532-106603554 GGACTGAGAGTCCTTTGCTGGGG + Intronic
1074755550 10:116621687-116621709 GGACTGGGCTTTCTTGGGAGAGG - Intronic
1077173971 11:1180492-1180514 GGACTGGCAGTTCTTGTCCGAGG - Intronic
1077628753 11:3796993-3797015 GGACTGGGCTTTATTTGCCTTGG - Intronic
1089908636 11:122072622-122072644 GGATTGTGCGCTCTTTACCGAGG + Intergenic
1094497349 12:30996624-30996646 GGCCTGGGGGTTCCTTGCAGAGG - Intergenic
1101037202 12:100717381-100717403 TGACTGGGCGTGCTCAGCCGCGG + Intergenic
1101112330 12:101498035-101498057 GGATTGGGTGTGCTTTGCTGTGG + Intergenic
1101246934 12:102892144-102892166 GGAGTGGGCTTTCCTTGCCTTGG + Intronic
1106299919 13:28454061-28454083 GGACTGGGGGTGCTCTGCCTGGG - Intronic
1112416724 13:99209063-99209085 GGACTGCGTGTTCCTTGCCCTGG + Intronic
1114529885 14:23389038-23389060 GGCCAGGGCGTTCTTCGCCTGGG + Exonic
1114535245 14:23418389-23418411 GGCCAGGGCGTTCTTCGCCTGGG + Exonic
1127851435 15:62915559-62915581 GGTCTGGGCTTTCTTTGTGGGGG - Intergenic
1127858318 15:62971397-62971419 GGACTGGGAGTTCCTTGCAGAGG + Intergenic
1137864797 16:51882467-51882489 GGACTGGGAGTTCTTTCCAGGGG - Intergenic
1141171187 16:81692725-81692747 GGCCTGGGCGCTCTTGGCTGTGG + Intronic
1142699211 17:1649311-1649333 GGAAGGGGCGTTCTTAGCGGCGG + Intronic
1142867943 17:2802247-2802269 AGACTGGCCGTACTTTGCCCAGG - Intronic
1145748374 17:27337496-27337518 TGATTGGGCGGTCTTTGCCTAGG + Intergenic
1153337361 18:3938462-3938484 GGAAAGGGCATTCTTGGCCGAGG + Intronic
1153545765 18:6203624-6203646 GGACTGGCTGTTCTTTTCCCTGG - Intronic
1159070188 18:63614089-63614111 GGGCTGGCTGTTCTTTGCTGGGG + Intergenic
1160442150 18:78901257-78901279 CTACTGAGCGTTCTGTGCCGGGG + Intergenic
1164109384 19:22140533-22140555 GGGCTGGGCGACCTTGGCCGTGG + Intergenic
1165740665 19:38203455-38203477 GGGCTGCGCGTTCTCTGCAGCGG + Intronic
930651843 2:53971136-53971158 GGGCTGCGCCTTCTTCGCCGTGG + Intronic
937907777 2:127060787-127060809 GGCCTGGGCGTGCTATCCCGGGG + Intronic
1176107084 20:63394553-63394575 GGACTGGGCTGTGTTTGCTGGGG - Intergenic
1176159343 20:63640664-63640686 GGAGTGGGCATTCTCTGCCAGGG - Exonic
1177697821 21:24596345-24596367 GGACTGGGGGTTCGGTGCTGGGG - Intergenic
1179058177 21:37955048-37955070 GGACTGGGCTTTGTTTACCTGGG + Intronic
1181778854 22:25178636-25178658 GGAGTGGGCATTCTCTGCCAGGG - Intronic
1183953085 22:41363198-41363220 GGACTGGGGGTTGTTTCCCAGGG - Intergenic
1185048401 22:48540526-48540548 GGACTGGGTCCTTTTTGCCGGGG - Intronic
949777762 3:7651578-7651600 GGACTGAGGATTCTTTGCCAAGG - Intronic
955832071 3:63015412-63015434 GGAGGGGGTGTTCTTTGCTGGGG + Intergenic
962356056 3:134695146-134695168 GGACTGGGCTCTCTGTGCTGCGG + Intronic
965799771 3:172479712-172479734 GGCCTGGGGGTCCTTTCCCGAGG - Intergenic
971331139 4:25682378-25682400 GGGCTGGGCGTTTTTGGCAGGGG - Intergenic
978739526 4:112121122-112121144 AGACAGGGTGTTCTTTGCCCAGG - Intergenic
992084641 5:73267139-73267161 GTACTGGGCTTTCTTTCCTGTGG + Intergenic
1001593094 5:172879817-172879839 GGGCTGGTCATTCTTTGTCGTGG + Intronic
1007257810 6:40540963-40540985 GCACTTGTCCTTCTTTGCCGGGG - Intronic
1011633858 6:89352679-89352701 GGACTGGGCGGCATTTGCCGAGG - Exonic
1018073843 6:160191698-160191720 GGCCTGGGGGTTCTCTGCCTGGG - Intronic
1018966987 6:168497105-168497127 GGGCTGGGCCTTCTTTCCCCAGG - Intronic
1021510291 7:21427211-21427233 GGAATGGGTGTTGTTTGCCTGGG - Intergenic
1035085359 7:156253353-156253375 GGACTGATAGTTCTTTGCTGTGG - Intergenic
1036009148 8:4701481-4701503 GGCCTGGGTGTTCTGTGCTGGGG - Intronic
1054805954 9:69395939-69395961 GGACTTGGCTTTCCTTGCAGAGG - Intergenic
1060401117 9:123350090-123350112 GGACTGGGGGTTGTTTGTCCTGG + Intergenic
1062076473 9:134592667-134592689 GGACTCAGCGTTCTTAGACGGGG + Intergenic
1192345627 X:70301988-70302010 CGACTGGGAGTTCATAGCCGTGG - Exonic
1198969520 X:142266170-142266192 GGAGTGGGCTTACTTTGCCCCGG - Intergenic