ID: 908258030

View in Genome Browser
Species Human (GRCh38)
Location 1:62318673-62318695
Sequence GGGATGCAGCCTGCGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258030_908258039 8 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
908258030_908258042 12 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258030_908258036 -2 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258030_908258038 7 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
908258030_908258041 11 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258030_908258043 13 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258030_908258044 14 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258030 Original CRISPR GGGATGCAGCCTGCGGGACT GGG (reversed) Intronic
900294359 1:1941455-1941477 GGGATGCAGCCAGCAGGCCTGGG + Intronic
900399444 1:2467054-2467076 TGGCTGCAGCCTGCGGGGCCTGG + Intronic
900413407 1:2523977-2523999 GGGATGGGGCCTGTGGGACAGGG - Intronic
901821469 1:11832944-11832966 GAGAGGCAGCCTGGAGGACTGGG + Intronic
902016005 1:13308008-13308030 GGGATGGAGGGTGAGGGACTAGG + Intronic
902208706 1:14889095-14889117 CGCATGCAGCCTGCGGGCCATGG + Intronic
902374336 1:16023226-16023248 GGGCTGCAGCCAGCGGGCCAGGG + Intronic
904029769 1:27527070-27527092 GGGTTGCAGGCTGTGGGGCTGGG - Intergenic
905029444 1:34871825-34871847 AGCATGCAGCCTGGGGCACTTGG - Intronic
905463496 1:38136330-38136352 GGGCTGCAGCCAGTGGGGCTGGG + Intergenic
906309878 1:44746171-44746193 GAGATGAAACCTGCAGGACTGGG - Intronic
907965260 1:59322706-59322728 TGGATGCAGCCTGCTGGCTTGGG + Intronic
908258030 1:62318673-62318695 GGGATGCAGCCTGCGGGACTGGG - Intronic
911759249 1:101597737-101597759 GGGCTGCTTCCAGCGGGACTAGG + Intergenic
913072042 1:115308171-115308193 GGGATGCAGGCTGCTGGAGCTGG + Intronic
916714613 1:167438698-167438720 AGGATGGAGCCAGCTGGACTGGG + Intronic
920043348 1:203117920-203117942 GGAACTCAGGCTGCGGGACTGGG + Intronic
922211454 1:223489862-223489884 CGGATGAAGCCTGGGGGAATGGG - Intergenic
923461614 1:234214126-234214148 GGGATGAGGGCTGCGGGGCTGGG + Intronic
923521939 1:234741617-234741639 GGGAGGCAGCCTAGGGGAATAGG + Intergenic
1062877390 10:954108-954130 GAGATCCAGCCTGCGTGCCTCGG - Intergenic
1065019808 10:21494895-21494917 GGGAGGCGGCCTGCGGACCTGGG - Exonic
1065083040 10:22145908-22145930 GAGATGAAGCCAGCTGGACTGGG + Intergenic
1065326889 10:24557196-24557218 GGGGTGCAGGCTGGGGGACGAGG + Intergenic
1070961518 10:80503122-80503144 GGGATGGAGCCTGCAGGATTCGG + Intronic
1072280445 10:93861046-93861068 TGGAAGCAGGCTTCGGGACTGGG + Intergenic
1072385986 10:94928645-94928667 GTGAGGCAGCCTGCTGGACCAGG - Intergenic
1075728337 10:124622106-124622128 GAGATGCAGCCCTCAGGACTGGG + Exonic
1077231465 11:1459798-1459820 GGGAGGCAGGCTGGGGGGCTGGG - Intronic
1077432304 11:2521952-2521974 GGGGTGCAGGCAGCGGGCCTGGG - Intronic
1077891119 11:6418940-6418962 GGGACGCAGCCACCGGGGCTGGG + Intronic
1083808791 11:65090725-65090747 GGGAGGCAGCCTGTGGGTCTTGG - Intronic
1084391426 11:68879804-68879826 TGGAGGCAGTCTGTGGGACTGGG - Intergenic
1085687037 11:78632945-78632967 GAGAAGCAGCCAGCGTGACTAGG + Intergenic
1085979459 11:81706122-81706144 GGCTTCCAGCCTTCGGGACTTGG - Intergenic
1087116380 11:94529293-94529315 GGGATGCAGCCTCTGGGATATGG + Intergenic
1090660780 11:128880375-128880397 GGGCTCCAGCCTGCGGGAGGTGG + Intergenic
1091545274 12:1497546-1497568 GGGCTGCAGTCTGCGAGTCTGGG - Intergenic
1096880067 12:54660108-54660130 TGGAAGCAGCCTGAGGGCCTCGG + Intergenic
1097040666 12:56154142-56154164 GGGATACAGCCTAGGGGATTAGG + Intronic
1097175852 12:57142519-57142541 GGGATGCAGAATGCGGGCCTGGG + Intronic
1101641278 12:106587091-106587113 GGGCTGCAGCCTCGGGGACTCGG - Intronic
1102394626 12:112575424-112575446 GGGACGCTGCCTCCGGGAATGGG + Intronic
1103555157 12:121761814-121761836 GGAATGCAGCCTGAGGGTGTCGG - Intronic
1107120834 13:36794378-36794400 GGGCTGCAGCCTGGGCGACAAGG + Intergenic
1114211861 14:20622805-20622827 GAGATGCTGCCTGCTGGCCTTGG + Intergenic
1117471171 14:56046445-56046467 GGAATGCAGCCTGGGTGCCTGGG - Intergenic
1118327043 14:64788305-64788327 GGGATGGAGGCTGAGGGACTAGG + Intronic
1119188107 14:72659034-72659056 GGGATGCAGCCTGCAGGAGGTGG - Intronic
1119844276 14:77816812-77816834 GGGATGCAGTCTTGGGGACTGGG + Intronic
1121309333 14:92926723-92926745 GGGCTGCTGCCTGCTGGGCTGGG + Intronic
1122862131 14:104587440-104587462 CGGATGCAGGCTGCTGGACAGGG - Intronic
1122935898 14:104956068-104956090 TGGGTGCAGCCTGCGAGACCTGG + Intronic
1123068738 14:105630767-105630789 GAGATGCAGCCAGAGGGACTGGG + Intergenic
1124551457 15:30684820-30684842 TGGATGGAGCTTGCAGGACTGGG + Intronic
1124679790 15:31720845-31720867 TGGATGGAGCTTGCAGGACTGGG - Intronic
1128059975 15:64729204-64729226 GGGAGGCAGGCTGGGTGACTGGG - Intergenic
1128361141 15:66962494-66962516 GGGAGGCAGCCCTCTGGACTGGG - Intergenic
1128374580 15:67065973-67065995 GCGCTGCAGCCTGCGGGGCTCGG - Exonic
1132660424 16:1058535-1058557 AGGATGCAGCTTGGGTGACTGGG - Intergenic
1132688019 16:1170348-1170370 GGGACGGAGCCAGCGGGACAGGG + Intronic
1133734884 16:8607417-8607439 GGGAGGGAGCCTGGGGGAGTTGG - Intergenic
1136736675 16:32473580-32473602 GGGCTGCAGCTGGCGGGCCTTGG - Intergenic
1137661452 16:50210349-50210371 GGGCTGAAGCCTGAGGGACTGGG - Intronic
1139636275 16:68260352-68260374 GGAACACAGCCTGCGGGACTGGG - Exonic
1142304628 16:89278500-89278522 GGGATGATGCCTGGGGAACTGGG + Intronic
1203016393 16_KI270728v1_random:355997-356019 GGGCTGCAGCTGGCGGGCCTTGG + Intergenic
1203034728 16_KI270728v1_random:629155-629177 GGGCTGCAGCTGGCGGGCCTTGG + Intergenic
1144314466 17:14046812-14046834 GGGAAGCAGTCTGTGGGTCTCGG - Intergenic
1144481747 17:15635683-15635705 GGGGTGGAGCCTGGGGTACTGGG - Intronic
1144772198 17:17766117-17766139 GGAATGCATCCTGCAGGACCAGG - Intronic
1144916553 17:18728089-18728111 GGGGTGGAGCCTGGGGTACTGGG + Intronic
1145795979 17:27655555-27655577 GTGAAGCAGCCTGCAGGACATGG - Intergenic
1145810430 17:27760880-27760902 GTGAAGCAGCCTGCAGGACGTGG - Intronic
1149449692 17:56739898-56739920 GGGAGGCAGCCTTCGGGTCCAGG - Intergenic
1150381722 17:64726064-64726086 GGTATCCAGCCTGCTGGCCTTGG - Intergenic
1150774543 17:68068826-68068848 GGTATCCAGCCTGCTGGCCTTGG + Intergenic
1151665534 17:75543284-75543306 GGGTGGCAGCCTACTGGACTTGG + Intronic
1151931380 17:77234120-77234142 GGGATGAGGTCAGCGGGACTTGG + Intergenic
1152066463 17:78115254-78115276 GGGGTGCAGCCAGTGGGCCTCGG - Intronic
1152791788 17:82283947-82283969 GGGATGCAGGATGCGGGATGCGG + Intergenic
1153470492 18:5439176-5439198 GGGTGGAAGCCTGGGGGACTGGG - Intronic
1156213893 18:34977189-34977211 GGTCTGCAGCCCGCGGGGCTCGG + Intronic
1157519639 18:48336767-48336789 GGGGAGCATCCTGGGGGACTGGG - Intronic
1157607206 18:48933349-48933371 GGGATGGAGCCGGCGGGAGGGGG - Intronic
1160013015 18:75120744-75120766 GGGCTGCAGCTTTCGGGACTGGG + Intergenic
1160619530 18:80160935-80160957 GGGAGGCAGCAGGCTGGACTGGG + Intronic
1160622556 18:80181104-80181126 GAGAAGCAGCCTGCGGGGGTGGG + Intronic
1160628353 18:80228569-80228591 GAGATGCAGTCTGTGGGCCTGGG - Intronic
1160724190 19:610428-610450 GGGAGGCAGCCTCCGGTACAGGG + Intronic
1161330225 19:3683372-3683394 GGGAAGCAGCCTGCGCCCCTGGG - Intronic
1162529544 19:11227918-11227940 GGGATGCAGCCAGCAGGCCCTGG + Intronic
1162760341 19:12885230-12885252 GGGTTGCAGAGGGCGGGACTTGG - Intronic
1162932357 19:13963369-13963391 GGGATCCAGCCTGAGTCACTGGG - Intronic
1163370027 19:16896656-16896678 GGGAACCAGCCTGGGGGACGAGG + Exonic
1163750499 19:19074292-19074314 GTGAGGCAGCCTGCGGGGTTGGG + Intronic
1164944941 19:32285631-32285653 GGCTTGCAGGCTGCGGGGCTGGG + Intergenic
1166136175 19:40778437-40778459 AGGATGCGGCCTGTGGGAATGGG + Intronic
1166380111 19:42351263-42351285 GGCATGCAGCCGGCGGGGCCGGG + Exonic
1166546888 19:43639496-43639518 GGGATCCAGCCTGCGCGGGTGGG + Intronic
1166813747 19:45529082-45529104 GGGGTGCAGGCGGCGGGTCTCGG + Exonic
1168115159 19:54218226-54218248 GGGAGGCAGCATGCTGGACAAGG + Intronic
1168120856 19:54251918-54251940 GGGAGGCAGCGTGCTGGACAAGG + Intronic
1168124435 19:54275815-54275837 GGGAGGCAGCGTGCTGGACAAGG + Intronic
1168177550 19:54635723-54635745 GGGAGGCAGCGTGCTGGACAAGG - Intronic
925902194 2:8516565-8516587 GGGAAGCAGCCTGCGGGATCGGG - Intergenic
927250618 2:20992186-20992208 GGAATGCAGCCTTCAGGCCTGGG + Intergenic
929000644 2:37344571-37344593 GGGCTGCAGCCTGCGCGACGCGG + Exonic
929458559 2:42084521-42084543 GGGCTCCAGCCTGCAAGACTGGG - Intergenic
929683461 2:44014032-44014054 GTGATGGGGCCTGCAGGACTGGG + Intergenic
932604681 2:73157104-73157126 GGGGTGCAGCCTGCCGGACCTGG + Intergenic
934187825 2:89762697-89762719 GGGCTGCGGCCCGCGGGCCTTGG - Intergenic
934503235 2:94874609-94874631 GGCAGGGAGCCTGAGGGACTGGG + Intronic
934585399 2:95488527-95488549 GGGCTGCAGCCTGTGGCAATGGG + Intergenic
934594066 2:95588229-95588251 GGGCTGCAGCCTGTGGCAATGGG - Intergenic
934818724 2:97353521-97353543 GGGCTGCAGCCTGTGGTTCTGGG - Intergenic
934974253 2:98789417-98789439 GGGATGCATCCTGAGGGACATGG - Intergenic
935423483 2:102894913-102894935 GGGGTGCAGCTTGTGGGAGTGGG + Intergenic
937208460 2:120252377-120252399 GGGATGCCGCCCGGGGGTCTTGG - Intronic
937891990 2:126946102-126946124 AGGGTGCAACCTGCAGGACTGGG - Intergenic
938030618 2:127989662-127989684 GGGATACAGCCTGCACCACTTGG - Exonic
938902023 2:135806524-135806546 TGAATGGAGCCTGCTGGACTGGG - Intronic
942559084 2:177201262-177201284 GGGCTGCAGCCTGGGCGACATGG + Intergenic
945819925 2:214651348-214651370 GGGACACAGCCTGCTGGATTTGG + Intergenic
948309006 2:236971254-236971276 GAGCTGCAGCCTGCCGGATTAGG - Intergenic
948646257 2:239406949-239406971 GGGATGCTGCCTGCGGGAAGTGG - Intergenic
948662307 2:239515099-239515121 GGGAGGCAGCTTGCTGGAGTTGG - Intergenic
948769832 2:240245984-240246006 AGGCTGCAGCCTGCGGGGGTAGG - Intergenic
949011688 2:241683369-241683391 TGCATGCAGCCTGCGGGCCTTGG - Intronic
1170844349 20:19949678-19949700 GGGATGCAGCTCGCGGGAGCGGG + Intronic
1171150311 20:22821874-22821896 GGGAAGCAGCCTGCAGCACATGG - Intergenic
1172280394 20:33703723-33703745 GGGATGCGGGCTGTGGGAGTGGG + Exonic
1175985108 20:62760723-62760745 GCCACGGAGCCTGCGGGACTGGG - Exonic
1176157223 20:63627764-63627786 GGGGTGCCAGCTGCGGGACTGGG - Intergenic
1176157257 20:63627861-63627883 GGGGTGCCGGCTGCGGGACTGGG - Intergenic
1176157315 20:63628054-63628076 GGGGTGCCGGCTGCGGGACTCGG - Intergenic
1176236046 20:64054018-64054040 GGGAAGCAGGCTGGGGGGCTGGG + Intronic
1176383067 21:6123026-6123048 GGGATGCAGCCTCCTGCACTGGG - Exonic
1177188048 21:17819403-17819425 GGGATGGAGCCGGCGGGAGAGGG - Intergenic
1178438289 21:32578469-32578491 GGGAAGCAGCCGGGAGGACTTGG + Intronic
1178573517 21:33763203-33763225 GGGGGGCGGCCTGGGGGACTTGG - Intronic
1179582382 21:42351969-42351991 AGGATGGAGCCTGGGGGACGAGG - Intergenic
1179740402 21:43415213-43415235 GGGATGCAGCCTCCTGCACTGGG + Exonic
1180050254 21:45327796-45327818 GGGCTGCCGCCTGCAGGGCTGGG + Intergenic
1180095314 21:45553683-45553705 GGGATGGGGCGTGGGGGACTGGG - Intergenic
1180095441 21:45553945-45553967 GGGATGGGGCGTGGGGGACTGGG - Intergenic
1180095558 21:45554188-45554210 GGGATGGGGCGTGGGGGACTGGG - Intergenic
1180095576 21:45554228-45554250 GGGATGGGGCGTGGGGGACTGGG - Intergenic
1180179157 21:46110188-46110210 GGGAGGCAGTCTGCGGGGTTGGG + Intronic
1181000335 22:19985172-19985194 AGGATGCAGCATGTGGGATTGGG - Intronic
1183785575 22:40027384-40027406 GGGTGGCAGCCTGGGGCACTCGG - Intronic
1184346930 22:43919290-43919312 CAGATGCAGCCTGGGGCACTGGG + Intergenic
1184376430 22:44116745-44116767 GGGATGCTGCCTGGAGGGCTGGG + Intronic
1185275029 22:49947056-49947078 GGGTTCCTGCCTGCGGGGCTTGG - Intergenic
1185333661 22:50262251-50262273 GGGATGCAGCCTGAGGAGTTTGG - Intergenic
953358620 3:42275733-42275755 GGGATGCAGTGTGGGGGTCTAGG + Intergenic
953815727 3:46154639-46154661 GGGATGCATTCTGCAGGACCTGG + Intergenic
953970077 3:47340367-47340389 GGGAGGCAGCCTGCGGTAGAAGG + Intronic
961603321 3:128076750-128076772 GGGATGCGGGCTGCAGGTCTGGG - Intronic
961824703 3:129592883-129592905 GGGATGCAGGCTGGGGGAGGGGG + Intronic
968707854 4:2091409-2091431 GAGATGGAGCCTGAGGGTCTGGG + Intronic
968965067 4:3765689-3765711 CGCCTGCAGCCTGCGGGACGGGG - Intergenic
969712611 4:8852602-8852624 GGGAGTCAGCCTCCGGGGCTGGG + Intronic
971889075 4:32494085-32494107 GGAATGCAGGCTCAGGGACTAGG - Intergenic
973853443 4:54986175-54986197 GAGAGGCAGCCTGCTTGACTGGG + Intergenic
981405251 4:144360266-144360288 GAGATGCTGCCTACCGGACTTGG - Intergenic
985419149 4:189765738-189765760 GAGTTGCAGCCTGCGGGAAAAGG + Intergenic
985720994 5:1489016-1489038 TGAAAGCAGCCTGCGGGGCTGGG - Intronic
988540145 5:32101024-32101046 GCGATGCATCCTGGGGGACTTGG + Intronic
988917143 5:35905847-35905869 GGGGTACAGCCTGTGGGCCTAGG - Intronic
990825470 5:59893464-59893486 GGGATGCAGGAGGCGGAACTGGG + Exonic
992296222 5:75329380-75329402 GGGAGGCAGCCTGTGGTACAGGG + Intergenic
992864331 5:80942218-80942240 GGGCTGCAGCCTGGGGCACTTGG - Intergenic
993647332 5:90476721-90476743 GGGATGCAGGCAGGGGGACCTGG - Intronic
996675383 5:126168630-126168652 GTGAGGCAGCCTGCTTGACTGGG - Intergenic
999148733 5:149412869-149412891 GGGAGGCTGCCTGCTGGCCTGGG + Intergenic
999583898 5:153069466-153069488 GGGATGCAGCCATGGGTACTGGG - Intergenic
1001602092 5:172935409-172935431 AGGAGGCAGCCTGCAGGGCTAGG + Intronic
1002092579 5:176813764-176813786 GAGCTCCAGCCTGCGGGTCTGGG - Intronic
1002386598 5:178871715-178871737 GAGATACAGCCAGCAGGACTTGG + Intronic
1002426059 5:179176613-179176635 GGGATGCTGGCAGCTGGACTGGG - Intronic
1002817265 6:692831-692853 GGGATGGGGGCTGCGGGGCTGGG + Intronic
1006130084 6:31863809-31863831 GGCAAGCTGCCTGCGGGATTTGG + Intronic
1006303344 6:33205455-33205477 GTGCTGCAGCCTGAGTGACTAGG - Exonic
1006794054 6:36721175-36721197 GGGAGGCAGCCTGAGGGTCTGGG - Exonic
1008466522 6:51837299-51837321 AGGCTGCAGCCTTGGGGACTCGG + Intronic
1012482651 6:99684485-99684507 GGCATGCAGCCCACGGGACATGG - Intergenic
1015197363 6:130537844-130537866 GTGATGCAGCCGGTGGCACTGGG - Intergenic
1016373086 6:143394213-143394235 GGGATGCAGACTGGGGGATGGGG + Intergenic
1016997485 6:149970621-149970643 GGAATGCAGCCTTTGGAACTGGG - Intronic
1017001315 6:149999555-149999577 GGAATGCAGCCTTAGGAACTGGG + Intergenic
1017011031 6:150064074-150064096 GGAATGCAGCCTTAGGAACTGGG + Intronic
1018042745 6:159939703-159939725 GGGATTCAGTCAGTGGGACTGGG + Intergenic
1018733916 6:166673255-166673277 GGGGTGCAGGCTGCGGCTCTAGG + Intronic
1018794774 6:167177337-167177359 GGGAAGCAGCTGGCAGGACTTGG - Intronic
1018821545 6:167377730-167377752 GGGAAGCAGCTGGCAGGACTTGG + Intronic
1019501790 7:1368511-1368533 GAGATGCAGGCTGGGGGCCTTGG - Intergenic
1019527129 7:1485427-1485449 GGAGGGCAGCCTGCGGGACGGGG - Exonic
1024510851 7:50203743-50203765 GGGATGGAGCCTGGGGGAGAAGG - Intergenic
1024619877 7:51148229-51148251 GGGAGGCAGCCAGAGTGACTGGG + Intronic
1027190788 7:75994522-75994544 GGGCGACTGCCTGCGGGACTGGG - Exonic
1027230352 7:76268433-76268455 GGGGGGCAGTCTGCGGGTCTGGG - Intronic
1028228368 7:88276012-88276034 TGGATTCAGACTGCGTGACTGGG - Intergenic
1028679667 7:93510972-93510994 GGAATGGAGCCTGGGGGATTAGG + Intronic
1029689760 7:102173549-102173571 GGGAGGCAGCCTTCAGGACAGGG + Intronic
1034431950 7:151045536-151045558 GGGAGGCAGCCGGCAGGACTGGG - Exonic
1034754133 7:153598672-153598694 GGGATGCAGCCTCCTGGGCCAGG - Intergenic
1037585043 8:20270373-20270395 GGGGTGCAGGGTGGGGGACTTGG - Intronic
1037669473 8:21001859-21001881 GGGGTGCAGGGTGCAGGACTGGG + Intergenic
1038331558 8:26613401-26613423 GGGATGCAGGCTGCAGGTGTGGG + Intronic
1038725014 8:30073979-30074001 GGGATCCAGCCTGCGGGAGGTGG + Exonic
1039882328 8:41632710-41632732 AGGCTGCAGGCTGCTGGACTTGG + Intergenic
1040487168 8:47884354-47884376 GTGATGCAGCCTTCGGAAGTTGG - Intronic
1042926283 8:73971821-73971843 GGGCAGCAGCCAGCGAGACTGGG - Intronic
1043389421 8:79777696-79777718 AGCATGCAGCCTGCTGCACTTGG - Intergenic
1049707278 8:144048778-144048800 GGGATGCAGCCAGCGGCACGTGG - Intergenic
1051663210 9:19444579-19444601 GGCATGCAGCCTGTGGGCCACGG + Intronic
1052569140 9:30198783-30198805 GGGCTGCAGCCTGCAGGGATTGG - Intergenic
1056913590 9:90725724-90725746 GGGCTGCAGCGTGCGGCTCTGGG - Intergenic
1056938530 9:90936401-90936423 GGGTACCAGCCTGGGGGACTAGG + Intergenic
1062190934 9:135247535-135247557 GGAATGAACCCTGCAGGACTGGG + Intergenic
1062460629 9:136661233-136661255 GGGTGACAGCCTGGGGGACTGGG + Intronic
1190274545 X:48891614-48891636 GGGCGGGAGCCTGCGGGTCTCGG + Intergenic
1190426681 X:50339864-50339886 GGGATGGAGCCTGCATGGCTTGG - Intronic
1195108814 X:101624902-101624924 GGGAGGAAGGCTGTGGGACTGGG - Exonic
1198084655 X:133270687-133270709 GTGGTGCAGGCTGTGGGACTGGG - Intergenic
1200112034 X:153745215-153745237 GGGCTGCGGCCGGCGGGCCTTGG + Intergenic
1201917681 Y:19199813-19199835 AGGTTCCAGCCTGCTGGACTTGG - Intergenic