ID: 908258031

View in Genome Browser
Species Human (GRCh38)
Location 1:62318674-62318696
Sequence TGGGATGCAGCCTGCGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258031_908258044 13 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258031_908258043 12 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258031_908258039 7 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
908258031_908258041 10 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258031_908258038 6 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
908258031_908258036 -3 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258031_908258042 11 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258031 Original CRISPR TGGGATGCAGCCTGCGGGAC TGG (reversed) Intronic
900246102 1:1636847-1636869 TGGGAGGCTGCGTGGGGGACAGG + Intronic
900257325 1:1703989-1704011 TGGGAGGCTGCATGGGGGACAGG + Intronic
900294358 1:1941454-1941476 GGGGATGCAGCCAGCAGGCCTGG + Intronic
900413408 1:2523978-2524000 GGGGATGGGGCCTGTGGGACAGG - Intronic
900608705 1:3535451-3535473 TTGGATGCAGCCTTCTGGAGAGG - Intronic
901044831 1:6389737-6389759 TGGCATCTAGCCTGGGGGACAGG + Intronic
901081104 1:6584708-6584730 TGGGCTTCAGCTTGCTGGACTGG + Intronic
901637294 1:10676247-10676269 TGAGAAGCAGCATGGGGGACGGG - Intronic
902374335 1:16023225-16023247 TGGGCTGCAGCCAGCGGGCCAGG + Intronic
902831956 1:19020751-19020773 TGCACTGCAGCCTGGGGGACAGG + Intergenic
903353449 1:22731923-22731945 TGGGATGAAGACTGGGGCACAGG - Intronic
903594791 1:24485742-24485764 TGGGATGCTGCCTGCAGCATAGG + Intergenic
905488892 1:38328136-38328158 TGTGATGCTGCCTGTGGCACAGG - Intergenic
906607519 1:47182322-47182344 TAGGATGCAGCCTGCAGCAGAGG - Intergenic
907965259 1:59322705-59322727 TTGGATGCAGCCTGCTGGCTTGG + Intronic
907998541 1:59657343-59657365 AGGGAGGCAGCCTCCTGGACAGG + Intronic
908258031 1:62318674-62318696 TGGGATGCAGCCTGCGGGACTGG - Intronic
911416148 1:97577317-97577339 GTAGATGCAGCCTGCTGGACTGG + Intronic
915382142 1:155451682-155451704 TGGAATCCAGCCTGGGCGACAGG + Intronic
915468068 1:156109360-156109382 TGGGATGGGGCCTGAGGGAGAGG - Intronic
920214309 1:204351155-204351177 TGGGATGCTGCTGGCAGGACTGG + Intronic
920280428 1:204839469-204839491 TGGGATGCAGGGTGCTGGAGGGG + Intronic
920707878 1:208267933-208267955 TGTGATACAGACAGCGGGACTGG + Intergenic
921939553 1:220826161-220826183 TGGGATGAAGACTGCAGGAAGGG + Intergenic
922036448 1:221852893-221852915 AGGGATGTAGCCTGGGGCACTGG + Intergenic
1063223461 10:3992639-3992661 TGGGGTGCAGGCTGAGAGACAGG - Intergenic
1064418322 10:15168920-15168942 TGGATTGAAGCCGGCGGGACGGG - Intergenic
1065099559 10:22320729-22320751 TGGGCCGCAGCCCGCGGGGCCGG + Intronic
1068047604 10:51907603-51907625 TGGGATCCAGCCTGCTTGGCTGG + Intronic
1069917830 10:71798199-71798221 TGTGCTGCAGCCTGAGGGTCAGG + Intronic
1070914282 10:80143073-80143095 TGGGCTCCAGCCTGGGTGACAGG - Intronic
1072416300 10:95249462-95249484 TGGGAGGCAGCCTGGTGGGCTGG - Intronic
1072682440 10:97516933-97516955 TCGGATGCTGACTGCGGGGCAGG + Intronic
1076250332 10:128979670-128979692 TGAGATGCAGCCTCCAGGCCTGG - Intergenic
1076487724 10:130835444-130835466 TGGGGTGCACCCTGTGGGAGGGG - Intergenic
1076487738 10:130835480-130835502 TGGGGTGCACCCTGTGGGAGGGG - Intergenic
1076830250 10:132990916-132990938 AGGGATGGAGCCCGAGGGACTGG - Intergenic
1077231466 11:1459799-1459821 TGGGAGGCAGGCTGGGGGGCTGG - Intronic
1077431464 11:2517848-2517870 TGGCATGCAGCCTGGGGGTGAGG + Intronic
1078740055 11:14058320-14058342 CAGGATGCAGCCTGTGTGACCGG + Intronic
1081963975 11:47158210-47158232 TGGGGAGCAGCCTGCAGGTCGGG + Intronic
1082625928 11:55485464-55485486 TGGGATGTAGCATGCCTGACAGG - Intergenic
1083773801 11:64883257-64883279 TGCTCTGCAGCCTGGGGGACAGG + Intronic
1083992891 11:66257779-66257801 CGGGATGGAGGCGGCGGGACCGG + Intronic
1085301781 11:75462930-75462952 TGGGAGGCAGCCTAAGGGGCTGG - Intronic
1085302207 11:75465378-75465400 TGGGATTCACCCTGTGAGACAGG - Intronic
1087182941 11:95157383-95157405 TGGGCTGCCGGCTCCGGGACTGG + Intergenic
1089902990 11:122007693-122007715 TGGGAAGAAGCCTGAGGCACGGG + Intergenic
1095980645 12:47972607-47972629 TGGGCTGCATCCTGCTGGATCGG - Intergenic
1097175851 12:57142518-57142540 CGGGATGCAGAATGCGGGCCTGG + Intronic
1103897291 12:124281166-124281188 TGGGATGCAGCCCCAGGGAAGGG - Intronic
1104013534 12:124948171-124948193 GGGGCTGCAGCCTGTGGGGCAGG + Exonic
1104568266 12:129903855-129903877 TGGGATGGGGGCTGCGGGCCAGG - Intergenic
1107474455 13:40721882-40721904 TGTGCTGCAGCCTGGGTGACAGG - Intergenic
1113070960 13:106420903-106420925 TGGAAAGCATCCTGAGGGACAGG - Intergenic
1115370727 14:32611140-32611162 GGGGATGGAGCCTGAGGGAAGGG + Intronic
1119844275 14:77816811-77816833 GGGGATGCAGTCTTGGGGACTGG + Intronic
1120073900 14:80134281-80134303 TGGGAGGGAGCATGCGGGAAAGG + Intergenic
1122862132 14:104587441-104587463 TCGGATGCAGGCTGCTGGACAGG - Intronic
1122961811 14:105097353-105097375 TGGGATGCAGCCTCCCAGAGAGG + Intergenic
1123068737 14:105630766-105630788 CGAGATGCAGCCAGAGGGACTGG + Intergenic
1124508125 15:30296491-30296513 TTGCATCCACCCTGCGGGACTGG - Intergenic
1124735429 15:32242165-32242187 TTGCATCCACCCTGCGGGACTGG + Intergenic
1125195453 15:37040980-37041002 TGAGATGCAGCCTCAGGAACAGG + Intronic
1126145768 15:45471485-45471507 TGGGATTCAGTCTGCGAGGCAGG + Intergenic
1130137275 15:81191844-81191866 TGGGATGCAGCGAGCAGGAGAGG + Intronic
1130149201 15:81298540-81298562 TGGGATGCAGCCTGGGTGTTGGG - Intronic
1132593155 16:735229-735251 CTGGACGCAGCCTGCTGGACTGG + Intronic
1132688018 16:1170347-1170369 TGGGACGGAGCCAGCGGGACAGG + Intronic
1132936227 16:2482718-2482740 TGGGAAGCAGCTGGAGGGACAGG + Intronic
1136124276 16:28166167-28166189 TGGGCAGCAGCCTGCAGGAGAGG - Intronic
1137661453 16:50210350-50210372 AGGGCTGAAGCCTGAGGGACTGG - Intronic
1137666747 16:50254258-50254280 TGGGCTGGAGCCTGCGGAAGCGG - Intronic
1138174530 16:54884563-54884585 TGGGATTCAGTCTGCGAGGCCGG + Intergenic
1139482201 16:67236793-67236815 TGGGGTGGGGCCTGCGGGGCGGG + Intronic
1139636276 16:68260353-68260375 TGGAACACAGCCTGCGGGACTGG - Exonic
1141464199 16:84195803-84195825 TGGGGGGCAGGCTGCGGGCCGGG - Exonic
1142140579 16:88471010-88471032 TGGGGTCCAGCCTCCGCGACAGG + Intronic
1143100168 17:4500173-4500195 TGGGAATCAGCCTTGGGGACGGG + Intronic
1143279520 17:5742070-5742092 TGGTTTGCAGCCTGGGGGTCAGG + Intergenic
1146048557 17:29531312-29531334 TGCAATGCAGCCTGGGCGACAGG - Intronic
1151574334 17:74944187-74944209 TGGGATGCAGCCTCTAGGATAGG - Intronic
1152554506 17:81046181-81046203 TGGGCTGGAGCCTGCAGAACGGG - Intronic
1154411132 18:14142854-14142876 TGGGATTCAGCTTGCTGGAGGGG + Intergenic
1157519640 18:48336768-48336790 TGGGGAGCATCCTGGGGGACTGG - Intronic
1157607207 18:48933350-48933372 GGGGATGGAGCCGGCGGGAGGGG - Intronic
1158343061 18:56487235-56487257 TGGGATGGAGTCAGGGGGACGGG + Intergenic
1159652974 18:70999556-70999578 TGGGAAGCAGCCTTGGGGAAAGG + Intergenic
1160013014 18:75120743-75120765 GGGGCTGCAGCTTTCGGGACTGG + Intergenic
1160562210 18:79765644-79765666 TGGGATCCACCCTACGGGGCTGG - Intergenic
1160619529 18:80160934-80160956 TGGGAGGCAGCAGGCTGGACTGG + Intronic
1160724189 19:610427-610449 CGGGAGGCAGCCTCCGGTACAGG + Intronic
1160930211 19:1566843-1566865 TGGGGTGCAGCCTGCTGGGCAGG - Intronic
1161934896 19:7365556-7365578 TGGGATGCAGGCAGTTGGACAGG + Intronic
1163750498 19:19074291-19074313 TGTGAGGCAGCCTGCGGGGTTGG + Intronic
1164944940 19:32285630-32285652 TGGCTTGCAGGCTGCGGGGCTGG + Intergenic
1166220015 19:41358051-41358073 TGGGAGGCAGCCATCGGGAAGGG + Intronic
1166380110 19:42351262-42351284 CGGCATGCAGCCGGCGGGGCCGG + Exonic
925069696 2:956496-956518 TGAGATGCAGCCTCCAGGAGAGG - Intronic
925240862 2:2326072-2326094 TGAGAAGCAGACTGCGGAACAGG - Intronic
925902195 2:8516566-8516588 TGGGAAGCAGCCTGCGGGATCGG - Intergenic
926061328 2:9806953-9806975 TGGGATGCCGACCGAGGGACGGG - Intergenic
926821028 2:16851872-16851894 TGCACTCCAGCCTGCGGGACAGG - Intergenic
927292627 2:21419900-21419922 TGGGATGTTGCCTGCGGCAGGGG + Intergenic
927936780 2:27080614-27080636 AGGGACCCAGCCTGAGGGACAGG + Intronic
929458560 2:42084522-42084544 TGGGCTCCAGCCTGCAAGACTGG - Intergenic
931200609 2:60093854-60093876 TTGCATACAGCCTGCAGGACTGG + Intergenic
931667902 2:64623398-64623420 TGGGAGGCAGCCTGGGAGAAGGG + Intergenic
932607619 2:73175631-73175653 TGGGCTGCAGCCGGCGGAAGGGG + Intergenic
934769726 2:96900165-96900187 TGGGATGCAGGCTGACGGACAGG - Intronic
934818725 2:97353522-97353544 TGGGCTGCAGCCTGTGGTTCTGG - Intergenic
935274385 2:101463578-101463600 TGGGAGACAGCCTGCCGGGCAGG + Intronic
935423482 2:102894912-102894934 TGGGGTGCAGCTTGTGGGAGTGG + Intergenic
936143515 2:109962252-109962274 ATGAATGGAGCCTGCGGGACTGG + Intergenic
936578627 2:113676140-113676162 TGGGATTCAGTCTGCGAGGCGGG + Intergenic
939015223 2:136895207-136895229 TGGGATGCTGCAGGCAGGACAGG + Intronic
940186094 2:150986156-150986178 TGGGATGCAGCATAGGGGGCAGG - Intergenic
946852654 2:223922077-223922099 TGGGATGCAGGCTCTGGGATGGG - Intronic
1169821016 20:9710151-9710173 TGAGAGGCAGCCTGTGGGAAGGG - Intronic
1170844348 20:19949677-19949699 GGGGATGCAGCTCGCGGGAGCGG + Intronic
1170975481 20:21160224-21160246 CTGGATGCAGCCTGCTTGACAGG + Intronic
1171143654 20:22763894-22763916 TGGGATGAAGCCAGGGGCACAGG + Intergenic
1171265718 20:23771021-23771043 TGGGATGTTACCTGCTGGACTGG - Intergenic
1171275465 20:23853455-23853477 TGGGATGTTGCCTGCTGGACTGG - Intergenic
1174535929 20:51251461-51251483 TGGGATTCAGCCTGAGAGGCGGG + Intergenic
1176157258 20:63627862-63627884 CGGGGTGCCGGCTGCGGGACTGG - Intergenic
1176236045 20:64054017-64054039 TGGGAAGCAGGCTGGGGGGCTGG + Intronic
1176383068 21:6123027-6123049 AGGGATGCAGCCTCCTGCACTGG - Exonic
1176861923 21:14015561-14015583 TGGGATTCAGCTTGCTGGAGGGG - Intergenic
1177188049 21:17819404-17819426 CGGGATGGAGCCGGCGGGAGAGG - Intergenic
1179740401 21:43415212-43415234 AGGGATGCAGCCTCCTGCACTGG + Exonic
1179787362 21:43737491-43737513 TGGGAAGGAGCCTGCGGAGCTGG + Intronic
1180075282 21:45458752-45458774 AGGGCTGCAGCCTGTGGGAGGGG + Intronic
1180095315 21:45553684-45553706 TGGGATGGGGCGTGGGGGACTGG - Intergenic
1180095442 21:45553946-45553968 TGGGATGGGGCGTGGGGGACTGG - Intergenic
1180095559 21:45554189-45554211 TGGGATGGGGCGTGGGGGACTGG - Intergenic
1180095577 21:45554229-45554251 TGGGATGGGGCGTGGGGGACTGG - Intergenic
1180751930 22:18130692-18130714 TGGGATGCAACAGGCGGGATGGG - Intronic
1181010065 22:20035056-20035078 TGGGAAGCAGACTGTGGGGCTGG - Intronic
1184878011 22:47287646-47287668 TGAGATGCAGCCTGCTTCACGGG - Intergenic
1185375929 22:50482585-50482607 TGGGCTGCAGGCTGCTGGAAGGG - Exonic
1185377311 22:50488419-50488441 TGGGATACTACCTGGGGGACAGG + Intronic
1185377341 22:50488505-50488527 TGGGATACTACCTGGGGGACAGG + Intronic
1185377373 22:50488592-50488614 TGGGATACTACCTGGGGGACAGG + Intronic
949209070 3:1476673-1476695 TGCACTGCAGCCTGCGTGACAGG + Intergenic
949363022 3:3251999-3252021 TGGGATTCAGTCTGTGAGACAGG - Intergenic
950485733 3:13273180-13273202 TGGGATTCAGGCTGCTGGCCTGG + Intergenic
952321655 3:32283505-32283527 TGAGCTGGAGCCTGCGGAACAGG + Intronic
953905110 3:46864768-46864790 TGGGATGGACCCTGGGGGCCGGG - Intronic
953910161 3:46888816-46888838 TGGGATGCAGCCTGGGATAGCGG - Intronic
958996735 3:100914363-100914385 TAAGATGCAGTCTGCGGAACAGG + Intronic
961824702 3:129592882-129592904 GGGGATGCAGGCTGGGGGAGGGG + Intronic
963944974 3:151135729-151135751 CAGGAAGCAGGCTGCGGGACTGG + Intronic
967439664 3:189492008-189492030 TCAGATGCTGCCTGCAGGACCGG + Intergenic
968131020 3:196192856-196192878 TGGGACGCTGCCTGCGGGGGAGG + Intergenic
968425922 4:523254-523276 TGGGACGCAGCCTGCAGGAGTGG - Intronic
968503545 4:961824-961846 TGTTGTGCAGCCTGCAGGACGGG + Exonic
968707853 4:2091408-2091430 TGAGATGGAGCCTGAGGGTCTGG + Intronic
968741455 4:2333525-2333547 TGGGGTGCGGCCTGCGGGGAGGG + Intronic
968931439 4:3581618-3581640 AGGGTAGCAGCCTTCGGGACAGG - Intronic
968965068 4:3765690-3765712 CCGCCTGCAGCCTGCGGGACGGG - Intergenic
970382389 4:15520926-15520948 TGGGAAGCAGCCAGTAGGACTGG + Intronic
970988574 4:22187100-22187122 TGGGATGCAGAATGAGGGATGGG + Intergenic
973221735 4:47734083-47734105 GAGGATGGAGCCTGGGGGACTGG + Intronic
981730608 4:147893092-147893114 TGCGCTCCAGCCTGGGGGACAGG - Intronic
983409873 4:167382796-167382818 TGCGCTCCAGCCTGGGGGACAGG - Intergenic
987093196 5:14525554-14525576 TGGGTTGCAGCCTGGGGCAGAGG - Intronic
988781007 5:34521844-34521866 TGGGAGGGAGCATGGGGGACAGG + Intergenic
992296221 5:75329379-75329401 TGGGAGGCAGCCTGTGGTACAGG + Intergenic
993517219 5:88852877-88852899 TGCGCTCCAGCCTGGGGGACAGG + Intronic
995556710 5:113337242-113337264 TGGGAAGCTGCCTGCTGGAGTGG - Intronic
999153633 5:149442729-149442751 TGGGATTCAGCCTGGGAGGCTGG - Intergenic
999583899 5:153069467-153069489 TGGGATGCAGCCATGGGTACTGG - Intergenic
999927115 5:156391071-156391093 TTGAATGGAGCTTGCGGGACTGG - Intronic
1001324461 5:170711908-170711930 TGGGTTGCAGATTGGGGGACAGG + Intronic
1001524254 5:172417334-172417356 TGGGATGCAGCCTGGGGCTGTGG + Intronic
1004056800 6:12147133-12147155 TGGGAAGCAGGCTGGGGGACAGG + Intronic
1005426949 6:25712865-25712887 TGGGATTCATCCTGAAGGACTGG + Intergenic
1006778470 6:36615264-36615286 TGCGCTCCAGCCTGGGGGACAGG + Intergenic
1006794055 6:36721176-36721198 GGGGAGGCAGCCTGAGGGTCTGG - Exonic
1007784097 6:44270543-44270565 TGGGAGGCAGGCTGGGGGGCCGG - Exonic
1010265290 6:73859094-73859116 TGGGATGCAGCCCTTGGGAAAGG + Intergenic
1011746716 6:90413607-90413629 TGGGACCCAGAGTGCGGGACGGG + Intergenic
1012350207 6:98240771-98240793 TGGCATCCAGCCTGGGTGACAGG + Intergenic
1013290484 6:108715166-108715188 TGCACTGCAGCCTGGGGGACAGG - Intergenic
1013605075 6:111739857-111739879 TGGGTTCCAGCCTGGGCGACAGG - Intronic
1014755848 6:125301649-125301671 GAGGAAGCAGCCGGCGGGACAGG - Intronic
1014759909 6:125344966-125344988 TGGGATGCAGCTTTGGGGATGGG + Intergenic
1015197364 6:130537845-130537867 TGTGATGCAGCCGGTGGCACTGG - Intergenic
1016130584 6:140463485-140463507 TGGGATGCAGCAGGCAGGACAGG - Intergenic
1016373085 6:143394212-143394234 GGGGATGCAGACTGGGGGATGGG + Intergenic
1016764790 6:147780241-147780263 TGTGCTCCAGCCTGGGGGACAGG - Intergenic
1019265685 7:116348-116370 TGGGAAGAAGCCTGCGAGCCTGG - Intergenic
1019505528 7:1388641-1388663 TGGTGAGCAGCCAGCGGGACAGG - Intergenic
1019527130 7:1485428-1485450 CGGAGGGCAGCCTGCGGGACGGG - Exonic
1019585003 7:1795772-1795794 GGGGATGCAGGTTGAGGGACTGG - Intergenic
1022538145 7:31110894-31110916 TGGGATGAAGACTGCTGGAAGGG + Exonic
1024001879 7:45195144-45195166 GGAGATGCAGCCAGCAGGACAGG + Intergenic
1024619876 7:51148228-51148250 TGGGAGGCAGCCAGAGTGACTGG + Intronic
1027190789 7:75994523-75994545 TGGGCGACTGCCTGCGGGACTGG - Exonic
1027230353 7:76268434-76268456 TGGGGGGCAGTCTGCGGGTCTGG - Intronic
1028228369 7:88276013-88276035 TTGGATTCAGACTGCGTGACTGG - Intergenic
1028235904 7:88361352-88361374 TGGGATTCAACCTGCGAGGCGGG - Intergenic
1029689759 7:102173548-102173570 TGGGAGGCAGCCTTCAGGACAGG + Intronic
1030593237 7:111506431-111506453 TGCACTGCAGCCTGGGGGACAGG - Intronic
1030979240 7:116166794-116166816 TAGGATTCAGCCTCCTGGACAGG - Intergenic
1034431951 7:151045537-151045559 AGGGAGGCAGCCGGCAGGACTGG - Exonic
1034470433 7:151251831-151251853 TGCGCCGCGGCCTGCGGGACGGG + Intronic
1034482644 7:151334470-151334492 TGGAATACAGCTTGCTGGACTGG + Intergenic
1034546010 7:151789858-151789880 TGGGTTGCAGCCTGCAGGGCCGG - Intronic
1035275440 7:157745452-157745474 TGGGAGGCAGGCTCAGGGACAGG + Intronic
1035456828 7:159014215-159014237 TGGGAGGCAGCCTTGGGGACGGG + Intergenic
1036587138 8:10134561-10134583 AGGGATTCATCCTGCGGCACAGG + Intronic
1037693042 8:21198969-21198991 TGATAGGCAGCCTGCGTGACTGG + Intergenic
1039696553 8:39918708-39918730 TGCGCTCCAGCCTGGGGGACAGG + Intronic
1039982241 8:42417653-42417675 TGGGATGGAGCCTCCTGGAAGGG + Exonic
1041212662 8:55568680-55568702 TGGGATGCAGTCTGCTGCCCTGG - Intergenic
1041359253 8:57033400-57033422 TGGACTGCAGCCTGGGTGACAGG + Intergenic
1044534279 8:93341667-93341689 TGGGATGCAGCGAGGGGGAAAGG - Intergenic
1044619522 8:94175345-94175367 TGGTATGCAGCTTCAGGGACAGG + Intronic
1048141899 8:131803021-131803043 TGTGCTCCAGCCTGGGGGACAGG - Intergenic
1051529806 9:18089114-18089136 TGCGCTGCAGCCTGGGCGACAGG + Intergenic
1052022403 9:23540500-23540522 TGGAATGTAGCCTGTGGGATGGG + Intergenic
1052820431 9:33134089-33134111 TGGGTTGGAGGCTTCGGGACAGG + Intronic
1054878506 9:70121317-70121339 TGGGATGGAGCCTGCAGTGCTGG - Intronic
1055470760 9:76608017-76608039 TGGGATTCAGCCTACTGGAAAGG - Intergenic
1057211560 9:93203485-93203507 TGGGAGGGAGCCTGTGGGAGTGG + Intronic
1057482899 9:95459674-95459696 TGGGAGGCAGCATACGCGACGGG + Exonic
1059439051 9:114292529-114292551 TTGAATGCAGCCTCTGGGACAGG - Intronic
1061786161 9:133030010-133030032 TGGGAAGCAGCCAGCCCGACGGG + Intergenic
1062185216 9:135214633-135214655 TGGGATGAAGCCAGGAGGACAGG + Intergenic
1062460628 9:136661232-136661254 TGGGTGACAGCCTGGGGGACTGG + Intronic
1203778660 EBV:88416-88438 TGGTATGGAGCCTGGGGGGCCGG - Intergenic
1196970917 X:121107652-121107674 TGGGATGCAGTATGCAGGAATGG + Intergenic