ID: 908258032

View in Genome Browser
Species Human (GRCh38)
Location 1:62318679-62318701
Sequence CGGTCTGGGATGCAGCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258032_908258041 5 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258032_908258036 -8 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258032_908258042 6 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258032_908258039 2 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
908258032_908258045 30 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258045 1:62318732-62318754 GCTGCACCACCTGAGTCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 108
908258032_908258044 8 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258032_908258043 7 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258032_908258038 1 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258032 Original CRISPR CGGTCTGGGATGCAGCCTGC GGG (reversed) Intronic
900107963 1:993568-993590 CGGTCAGGGATGAGGTCTGCTGG - Intergenic
901228537 1:7629192-7629214 CTGTCAGGGATGCAGGCTGCTGG - Intronic
902374334 1:16023220-16023242 CAGGCTGGGCTGCAGCCAGCGGG + Intronic
904413640 1:30341603-30341625 CTGGCTGGGATCCAGGCTGCAGG - Intergenic
904585323 1:31576784-31576806 AGGTCAGGGATGGAGGCTGCTGG + Intronic
904605173 1:31694276-31694298 GGGGCTGGGATACAGGCTGCTGG - Intronic
905178181 1:36150924-36150946 CGGTCTGGGCTCCTCCCTGCCGG + Intronic
906537233 1:46558218-46558240 CGGCTGGGGCTGCAGCCTGCAGG - Exonic
908258032 1:62318679-62318701 CGGTCTGGGATGCAGCCTGCGGG - Intronic
908910156 1:69063831-69063853 TGGCCTGTGATGCAGCCTTCAGG + Intergenic
913072041 1:115308165-115308187 AAATCTGGGATGCAGGCTGCTGG + Intronic
916716960 1:167454880-167454902 CGCTCTGGGATCCGTCCTGCCGG + Intronic
918571293 1:185996380-185996402 CAGTCTGGAATGCAGCCAGCTGG - Intronic
921373762 1:214452048-214452070 CAGGGTGGGATGCAGCATGCTGG - Intronic
922715724 1:227870225-227870247 TGGTCTCGGCTGGAGCCTGCAGG - Intergenic
1062798133 10:359402-359424 ATGTCTGGGCTGCTGCCTGCCGG + Intronic
1063008814 10:2002314-2002336 CACTCAGGGATGGAGCCTGCTGG - Intergenic
1071567978 10:86681309-86681331 CGCTCTGGGCTTCAGGCTGCGGG + Intronic
1072546654 10:96445266-96445288 CCGTCTGGCCTGCATCCTGCAGG - Intronic
1073337168 10:102718493-102718515 TGGTCTTTGAAGCAGCCTGCAGG + Intronic
1073453041 10:103620574-103620596 TGGTCGGGGAGGCAGGCTGCAGG - Intronic
1074954962 10:118379836-118379858 CGGTCTGAGATGGGGCCTGGGGG + Intergenic
1075634411 10:124020449-124020471 GGATCTGGGAGGCAGCATGCAGG - Intronic
1076852604 10:133100392-133100414 CACACTGGGATGAAGCCTGCTGG + Intronic
1077187028 11:1239996-1240018 GGGCCTGGGGGGCAGCCTGCAGG - Intronic
1077755842 11:5026194-5026216 CTCTCTGGGATGGAGCCTCCAGG + Intergenic
1077941585 11:6848848-6848870 AGGTGTGGGATGCAGGATGCTGG - Intergenic
1078734076 11:14003525-14003547 CAGTTTGGGATTAAGCCTGCTGG + Intronic
1082009043 11:47438133-47438155 GGGGCTGGGATGCATCCTGGTGG + Intronic
1084125571 11:67096789-67096811 CCTGCTGGGAGGCAGCCTGCTGG - Intergenic
1088409603 11:109519871-109519893 TGGTTTGGGAGGCAGCCTCCTGG + Intergenic
1089073413 11:115718061-115718083 GGGTGTGGGAAGAAGCCTGCAGG + Intergenic
1089407897 11:118213843-118213865 AGGTCTGTGGAGCAGCCTGCAGG - Intronic
1089679802 11:120113005-120113027 GGGTTTTGGAGGCAGCCTGCTGG - Intronic
1090075202 11:123576244-123576266 AAGGCTGGGATGCAGCCTGCAGG + Intronic
1090192694 11:124785669-124785691 CTGTCTGGAATGCTGACTGCTGG - Intronic
1090407919 11:126488458-126488480 CAGTCGTGGAGGCAGCCTGCTGG + Intronic
1098193546 12:67976434-67976456 CCGTCTGGGATGAAGCTTCCAGG - Intergenic
1099894161 12:88624042-88624064 AGGTCTGGGATTCAGCCTTAGGG + Intergenic
1101434350 12:104652365-104652387 CGGCCTGAGCTGCTGCCTGCAGG - Intronic
1102148886 12:110674868-110674890 TGGACTGAGATCCAGCCTGCAGG + Intronic
1102942386 12:116954891-116954913 GGGGCTGGGATGGAGCCAGCTGG - Intronic
1104568268 12:129903860-129903882 CGGCCTGGGATGGGGGCTGCGGG - Intergenic
1108510080 13:51148223-51148245 AGGACTGGGAGGCAGGCTGCTGG - Intergenic
1113627802 13:111859186-111859208 CTGCCTGGGAGGCAGCCTGCAGG + Intergenic
1113889616 13:113728970-113728992 CAGTGTGGGCTGCAGCCTCCGGG - Intronic
1113897767 13:113776659-113776681 GGGGCTGGGGTGCAGCCTCCCGG + Intronic
1118817696 14:69324521-69324543 CAGTGTGGGATGCAGCATGGGGG + Intronic
1121520389 14:94582103-94582125 CGGCCTGGGTGGCAGCCTCCAGG - Intronic
1122217994 14:100216694-100216716 CAGGCTGGAATGCAGCCTCCTGG + Intergenic
1122287627 14:100661090-100661112 CGGCCTGGGAAGCAGGCGGCCGG - Intergenic
1122362243 14:101174359-101174381 AGGTCTGGGGTGCAGGCTGGTGG - Intergenic
1122785638 14:104162202-104162224 CAGGCTGGGGTGCAGCCTGTTGG + Intronic
1122804554 14:104249974-104249996 CGGCTGGGGATGCTGCCTGCAGG + Intergenic
1122862133 14:104587446-104587468 CTGTCTCGGATGCAGGCTGCTGG - Intronic
1124836655 15:33202003-33202025 CCCTCAGGGATGCAGCCTGGTGG - Intergenic
1126163486 15:45634823-45634845 CGGCCTGGGGTGCTGCCGGCTGG - Exonic
1126693675 15:51308110-51308132 TGCTCTGGGATGCAACATGCAGG + Intronic
1127956422 15:63857733-63857755 GTGTCTGGGGTGCAGCCTCCTGG - Intergenic
1131438658 15:92442366-92442388 CAGTCTGGGATGCCACCTCCTGG - Intronic
1131975133 15:97936798-97936820 GGGTCCTGGAGGCAGCCTGCAGG - Intergenic
1133748274 16:8703963-8703985 TGCTCTGGGATGCAGACTGTAGG - Intronic
1134121425 16:11587093-11587115 GGGTGTGGGATGGAGCCTGGGGG - Intronic
1135868393 16:26126319-26126341 GGAGCTGGGATGCAGCCTGCAGG + Intronic
1136576255 16:31127095-31127117 GGGGCTGGGAAGCTGCCTGCAGG + Intronic
1137009525 16:35309220-35309242 TGGTGTGGGCTCCAGCCTGCAGG - Intergenic
1141441656 16:84033302-84033324 AGGGCTGGGATGCTGCCTGGTGG - Intronic
1141839815 16:86567320-86567342 CCGTCTCGGAAGCAGCATGCAGG + Exonic
1142161017 16:88557624-88557646 CGGGCAGGGCTGCAGGCTGCAGG - Intergenic
1142237118 16:88927582-88927604 CAGCCTGGCATGCAGCCTGCAGG + Intronic
1142971158 17:3612602-3612624 TGGTGTGGGTTGCAGGCTGCGGG + Intronic
1145287060 17:21513701-21513723 CAGTCTGTGAAGCAGCCAGCTGG + Intergenic
1147251781 17:39156927-39156949 AAGTCTGGCAGGCAGCCTGCAGG + Exonic
1151232591 17:72695372-72695394 CTGCCTGGGCTGCAGCCAGCTGG + Intronic
1151574335 17:74944192-74944214 GGGTATGGGATGCAGCCTCTAGG - Intronic
1152000036 17:77639561-77639583 CTGCCTGGGGTCCAGCCTGCTGG + Intergenic
1155201800 18:23524285-23524307 CAGTCAGGGAAGCTGCCTGCGGG - Intronic
1160672409 19:372453-372475 TGGACTGGGAAGCAGCCTGCTGG + Intronic
1160930213 19:1566848-1566870 ACTTCTGGGGTGCAGCCTGCTGG - Intronic
1161108701 19:2456625-2456647 CGGGCGGGGGTGCAGCCGGCAGG - Intronic
1163203781 19:15787561-15787583 CTGCCTGGGATGCAGGATGCAGG - Intergenic
1164922298 19:32097540-32097562 TGGTCTGGGATGCAGAGGGCTGG - Intergenic
1166308789 19:41950737-41950759 CAGTCTGGGATCCAGCTGGCTGG - Intergenic
1166317681 19:41998172-41998194 CGGGCTGGCCTGCAGCCTGTAGG + Intergenic
1166622456 19:44314162-44314184 CGGTTTGGGTTCAAGCCTGCTGG - Intergenic
1167307162 19:48715797-48715819 CGGCCTGGCTTGCTGCCTGCAGG - Intronic
925164167 2:1705369-1705391 CGACCTGGGATGCAGGGTGCAGG + Intronic
926757481 2:16247849-16247871 GGATCTGGGAGGCTGCCTGCAGG + Intergenic
927553975 2:24019903-24019925 CAGTCTAGGATACAGCCTTCTGG - Intronic
928635905 2:33246558-33246580 CAGCCAGGGATGAAGCCTGCAGG + Intronic
931007486 2:57868463-57868485 CAGTCTGGGATATATCCTGCAGG + Intergenic
932461147 2:71882786-71882808 GGATCTGGGATGCAGGGTGCTGG + Intergenic
932641580 2:73452632-73452654 CTGTCTGGGATGGAGTCTTCTGG - Exonic
934769727 2:96900170-96900192 GGCTCTGGGATGCAGGCTGACGG - Intronic
938773903 2:134524289-134524311 TGGTCTGGGAAGCAGCCTAGGGG + Intronic
943309744 2:186310880-186310902 TGGTCTGGGATTCACCCTTCAGG - Intergenic
946469592 2:219946191-219946213 GGTTCTGGGATGCTGCCAGCTGG + Intergenic
948265137 2:236630342-236630364 CGTTCTGACCTGCAGCCTGCAGG + Intergenic
948755100 2:240154984-240155006 CCATCTGGGATGCAGGCAGCTGG + Intergenic
1168951186 20:1803321-1803343 AGGTCTGGGGCGCAGCCTCCAGG - Intergenic
1169527514 20:6446039-6446061 AGGTCTGGTGTGCAGCCTACAGG - Intergenic
1170235316 20:14097032-14097054 AAGTGTGGGATGAAGCCTGCAGG - Intronic
1172009969 20:31841065-31841087 CAGCCTGGCATGCCGCCTGCTGG - Intergenic
1175877616 20:62237952-62237974 CGGTCGGGGATGCAGCTGGAGGG + Intronic
1176035005 20:63031885-63031907 GCGTCAGGGCTGCAGCCTGCTGG + Intergenic
1179411060 21:41163541-41163563 CGGTTATGGATGCAGCCTGTAGG + Intergenic
1179731373 21:43369595-43369617 GGGTCTTGGATGAAACCTGCGGG + Intergenic
1180802519 22:18638446-18638468 GGGTCAGGGAGGCAGCCTGGGGG + Intergenic
1180853756 22:19034002-19034024 GGGTCAGGGAGGCAGCCTGGGGG + Intergenic
1181219204 22:21356815-21356837 GGGTCAGGGAGGCAGCCTGGGGG - Intergenic
1183095447 22:35549185-35549207 CAGTCTGGCATGGAGCCTTCCGG + Intronic
1184286093 22:43472488-43472510 GGGTCTGGGATCCAGGCTGCTGG + Intronic
1184670188 22:46008176-46008198 CGGGCTGGGCTGCAGCAGGCAGG + Intergenic
1185186170 22:49401770-49401792 AGGCCCGGGAAGCAGCCTGCAGG - Intergenic
955005622 3:54965902-54965924 AGGACGAGGATGCAGCCTGCTGG + Intronic
955352352 3:58203193-58203215 GGGCCCTGGATGCAGCCTGCTGG - Intronic
955420174 3:58727846-58727868 CGTTCTGGGATGCAGGCTGATGG + Intronic
961682863 3:128610610-128610632 TCTTCCGGGATGCAGCCTGCCGG - Intergenic
961755131 3:129122485-129122507 CGGTCTGGGAGGCAGCAGGTAGG - Intronic
968381669 4:101719-101741 CTGTCTGGGATGGAGTGTGCAGG - Intergenic
976832327 4:89329698-89329720 TGGTCTGGGTAGCAGGCTGCTGG + Intergenic
981686363 4:147459087-147459109 AGGGCTGGGATGCAGACAGCTGG + Intergenic
982026643 4:151258607-151258629 GTGTCTGGGATTCAGCCTGAGGG - Intronic
983538063 4:168878478-168878500 CGCTCTGGGTTGCAGGCTGATGG - Intronic
985057941 4:186051330-186051352 CGCTCTGGGAAGCAGGCTGCAGG - Intergenic
985416486 4:189740991-189741013 GGGTGTGGGATGCAGCGTGGGGG - Intergenic
985789001 5:1915439-1915461 CTGTCAGGCATTCAGCCTGCAGG - Intergenic
986093535 5:4534692-4534714 AAGTCTGGGATGCTGCCTGTGGG + Intergenic
992080461 5:73231125-73231147 CTGTTTGGGGTGCGGCCTGCAGG + Intergenic
992775171 5:80082917-80082939 CGGTTTGCAAAGCAGCCTGCAGG + Intronic
995830340 5:116348296-116348318 CTGGCTGGGAACCAGCCTGCAGG + Intronic
997766181 5:136505971-136505993 CGCTCTGGGATGCAGCTGCCAGG + Intergenic
998185430 5:139975531-139975553 AGGTCTGGGATGAGCCCTGCAGG + Intronic
1001547548 5:172579880-172579902 TGGTGTGGGCAGCAGCCTGCTGG + Intergenic
1003135985 6:3435119-3435141 GGGGCTGGGATTCAGGCTGCTGG + Intronic
1003426745 6:6002943-6002965 GGGTCTCGGCTGCAGCGTGCGGG + Intronic
1003620093 6:7691944-7691966 CGTTCTGGGTTGCAGCCTATTGG + Intergenic
1004230839 6:13831623-13831645 CGGTGTGGTAGGCAGCCTCCAGG + Intergenic
1006374073 6:33662319-33662341 GGGTCTGGGATGCGGGCTGAGGG + Intronic
1006939369 6:37741935-37741957 CCCTCTGGGATGAAGCCAGCAGG - Intergenic
1007775328 6:44221785-44221807 CCGTCTGGCATCCATCCTGCTGG - Intronic
1008623791 6:53298208-53298230 CTGTTTGGGATGCAGCCTAGTGG - Intronic
1015708125 6:136110239-136110261 CAATATGGGATACAGCCTGCGGG + Intronic
1015762326 6:136677596-136677618 CCATCTGGGATCCAGCCTGAAGG + Intronic
1019181160 6:170187928-170187950 AGGTCTGGGATGCTGCATCCTGG + Intergenic
1019181348 6:170188912-170188934 GGGTCTGGCATGCACCCTGGAGG - Intergenic
1021561632 7:21973446-21973468 TGGTCTGGAATCCAACCTGCAGG + Intergenic
1022509573 7:30926514-30926536 AGGCCTGGGATGCAGCGGGCTGG - Intergenic
1023796512 7:43797550-43797572 TGGTCTGGAATGAAACCTGCAGG + Intronic
1024179667 7:46878951-46878973 CGGGATGGGCTGCAGCCTGCAGG - Intergenic
1024958996 7:54955855-54955877 TGGTCTGGGATGCCAGCTGCCGG - Intergenic
1026326034 7:69311349-69311371 CACTCTGGGATCCAGGCTGCAGG - Intergenic
1027230350 7:76268419-76268441 GGGTCTGGGAAGGAACCTGCAGG - Intronic
1029736763 7:102469498-102469520 CAGCCTGGGATGCAGCCAGCAGG + Intronic
1034546012 7:151789863-151789885 GGGCTTGGGTTGCAGCCTGCAGG - Intronic
1037359206 8:18054861-18054883 CGGTGTGGTCTGGAGCCTGCTGG + Intergenic
1038331556 8:26613395-26613417 TGGGCAGGGATGCAGGCTGCAGG + Intronic
1038725012 8:30073973-30073995 TGGGATGGGATCCAGCCTGCGGG + Exonic
1039002310 8:32995255-32995277 TGGTCTGGGACACAGCCTTCAGG + Intergenic
1039042155 8:33418106-33418128 CAGTGTAGGATGCAGTCTGCTGG - Intronic
1039982239 8:42417648-42417670 CAGTGTGGGATGGAGCCTCCTGG + Exonic
1040887321 8:52278885-52278907 TGGTCTGGGTTGCCTCCTGCTGG + Intronic
1041321515 8:56618653-56618675 CTGTCTGGCATCCAGCCTGGAGG + Intergenic
1041511509 8:58659360-58659382 TGGTCTGGGCCGGAGCCTGCCGG - Exonic
1042042683 8:64609935-64609957 TGGTCTGGGGTGCAGACTGATGG - Intronic
1046867256 8:119164720-119164742 GGGTCAGGGAGGCAGTCTGCCGG + Intergenic
1052569144 9:30198789-30198811 CTCCCTGGGCTGCAGCCTGCAGG - Intergenic
1052728432 9:32258246-32258268 TTGTCTGGGATGCAGGGTGCAGG - Intergenic
1056822797 9:89855300-89855322 GGGTCTGGGATGCAGAATACAGG + Intergenic
1057514667 9:95711117-95711139 CGGTCAGGGCTGCTGTCTGCTGG - Intergenic
1060375264 9:123111129-123111151 GGGTCAGGGCTGCAGCCTGAGGG + Intronic
1061993937 9:134174709-134174731 CTGCCTGGGATGGACCCTGCAGG - Intergenic
1190108411 X:47574417-47574439 CGGCCTGGGACGCGGGCTGCTGG + Exonic
1192433695 X:71129356-71129378 GGTTCTGGGAGGCAGCCAGCAGG - Exonic
1195269390 X:103215333-103215355 CGGTCCGCGATGCAGCCCCCGGG + Intronic
1195834865 X:109102804-109102826 TGGTCTGGGATTCACCCTTCAGG + Intergenic
1197175933 X:123485889-123485911 AGGTCTGGGATGGGGCCTGAGGG + Intronic
1198182072 X:134220010-134220032 AGGGCTGTGATGCAGCCAGCTGG - Intergenic