ID: 908258033

View in Genome Browser
Species Human (GRCh38)
Location 1:62318680-62318702
Sequence GCGGTCTGGGATGCAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258033_908258045 29 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258045 1:62318732-62318754 GCTGCACCACCTGAGTCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 108
908258033_908258042 5 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258033_908258038 0 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258038 1:62318703-62318725 AGCGCCTAGCTCGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
908258033_908258036 -9 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258036 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG No data
908258033_908258039 1 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258039 1:62318704-62318726 GCGCCTAGCTCGGAAAAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
908258033_908258043 6 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258033_908258044 7 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258033_908258041 4 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258033 Original CRISPR GCGGTCTGGGATGCAGCCTG CGG (reversed) Intronic
No off target data available for this crispr