ID: 908258034

View in Genome Browser
Species Human (GRCh38)
Location 1:62318693-62318715
Sequence CGAGCTAGGCGCTGCGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258034_908258041 -9 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258034_908258045 16 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258045 1:62318732-62318754 GCTGCACCACCTGAGTCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 108
908258034_908258042 -8 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258034_908258043 -7 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258034_908258044 -6 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258034_908258048 25 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258048 1:62318741-62318763 CCTGAGTCGCAAGGACAGCACGG 0: 1
1: 0
2: 1
3: 17
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258034 Original CRISPR CGAGCTAGGCGCTGCGGTCT GGG (reversed) Intronic
900435292 1:2628229-2628251 AGGGCCAGGGGCTGCGGTCTGGG + Intronic
902362929 1:15951843-15951865 CGTGCTAGGAGGTGCTGTCTGGG + Intronic
908258034 1:62318693-62318715 CGAGCTAGGCGCTGCGGTCTGGG - Intronic
922812496 1:228425360-228425382 CGAGCAATCCGCTGAGGTCTGGG - Intergenic
1064938192 10:20703902-20703924 GGAGCCAGGGGCTGCGGTCAGGG - Intergenic
1069846736 10:71377371-71377393 CGAGCTGAGCGCGGCGGGCTCGG - Intergenic
1076735853 10:132458637-132458659 CGGGCTGGGCGCTGCGGGCTGGG - Intergenic
1077095025 11:795598-795620 CGAGCTAGGGGCTGGGGTCCCGG + Intronic
1079299210 11:19262518-19262540 GGAGCTGGGCACTGGGGTCTTGG - Intergenic
1084105615 11:66978393-66978415 AGAGCTAGGCACTGGGGTCCTGG - Intergenic
1084312449 11:68324904-68324926 GGTGCTAGGCGCTGGGCTCTGGG + Intronic
1085238443 11:75032722-75032744 CCAGCTAGGAGCTGGGGCCTTGG - Intergenic
1103786423 12:123436439-123436461 CGACCTCGGAGCTGCTGTCTTGG + Exonic
1104995072 12:132649223-132649245 CCAGCTGGGCCCTGAGGTCTGGG - Intronic
1134531996 16:14990251-14990273 CGGGGTGGGCGCCGCGGTCTGGG - Intronic
1136238116 16:28927165-28927187 CAAGCTTGGAGCTGAGGTCTCGG + Intronic
1143637814 17:8176434-8176456 CGGGCTCGGCGCCGCGTTCTCGG + Intergenic
1144686458 17:17229168-17229190 AGAGCCAAGCGCTGCGGTCGGGG + Intronic
1160861168 19:1237737-1237759 TGAGGTAGGCGCGGCGGGCTCGG - Exonic
1167557087 19:50203418-50203440 GGAGCTAGGCGGCGCGGTCGGGG - Intronic
926422593 2:12715028-12715050 CGGGCTAGACCCTGCGCTCTTGG + Intergenic
936439889 2:112542340-112542362 CGCCCTAGGCCCTGCGGTTTCGG - Intronic
937334339 2:121052275-121052297 AGAGCCAGGCGCTGCGGCCAAGG - Intergenic
1177827517 21:26100998-26101020 GGAGCTAGGGGCTAGGGTCTAGG - Intronic
1177894777 21:26845534-26845556 CGCGCTCCGCGCTGCGGGCTCGG + Intergenic
985552965 5:542578-542600 CGACCTCGGAGCTGAGGTCTGGG + Intergenic
985580429 5:693081-693103 GGAGTTCGGCGCTGCGGGCTCGG - Intronic
985595091 5:784471-784493 GGAGTTCGGCGCTGCGGGCTCGG - Intergenic
991594372 5:68288012-68288034 CGAGCGAGGCGCTGTGTTCTGGG + Intronic
1026115936 7:67495717-67495739 AGAGGTAGGCGCTTGGGTCTGGG + Intergenic
1026897812 7:74020378-74020400 AGAGCTTGGTGCTGAGGTCTTGG - Intergenic
1036171288 8:6488185-6488207 GGAAGCAGGCGCTGCGGTCTAGG + Intronic
1043053252 8:75407447-75407469 CGGGAGAGCCGCTGCGGTCTCGG + Intergenic