ID: 908258035

View in Genome Browser
Species Human (GRCh38)
Location 1:62318694-62318716
Sequence CCGAGCTAGGCGCTGCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258035_908258044 -7 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258044 1:62318710-62318732 AGCTCGGAAAAGCTGGGCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 102
908258035_908258048 24 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258048 1:62318741-62318763 CCTGAGTCGCAAGGACAGCACGG 0: 1
1: 0
2: 1
3: 17
4: 270
908258035_908258043 -8 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258043 1:62318709-62318731 TAGCTCGGAAAAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 10
4: 130
908258035_908258042 -9 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258042 1:62318708-62318730 CTAGCTCGGAAAAGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 111
908258035_908258041 -10 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258035_908258045 15 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258045 1:62318732-62318754 GCTGCACCACCTGAGTCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258035 Original CRISPR CCGAGCTAGGCGCTGCGGTC TGG (reversed) Intronic
901483208 1:9539947-9539969 CCGCCCTCGGGGCTGCGGTCAGG - Intronic
901836361 1:11926329-11926351 CCGGGGTGGGCGCCGCGGTCCGG - Exonic
905038095 1:34930136-34930158 CCAAGCCAGGAGCTGAGGTCAGG - Intergenic
907664673 1:56424428-56424450 CAGTGCTAGGCTCTGTGGTCAGG - Intergenic
908128081 1:61050311-61050333 CCGAGCTTGGCGCTCCGGGGCGG + Intronic
908258035 1:62318694-62318716 CCGAGCTAGGCGCTGCGGTCTGG - Intronic
912167461 1:107057458-107057480 CTGAGCAAAGCGCTGCGGCCGGG - Exonic
1064938193 10:20703903-20703925 AGGAGCCAGGGGCTGCGGTCAGG - Intergenic
1069703246 10:70441321-70441343 CAGAGCTAGGCCCTGGGCTCGGG + Intronic
1073428541 10:103471269-103471291 CCGACCTACTGGCTGCGGTCAGG - Intergenic
1076735854 10:132458638-132458660 GCGGGCTGGGCGCTGCGGGCTGG - Intergenic
1077495897 11:2886272-2886294 CGGAGCTGGGCGCCGGGGTCCGG - Intergenic
1081730486 11:45368690-45368712 CCGAGTTAGGTGCTGGGGACAGG + Intergenic
1081870817 11:46381796-46381818 CCGATCTAGGGGCTGGGGGCTGG + Intronic
1084371610 11:68749065-68749087 CCGAGCTAGGACCTACGGGCAGG + Intronic
1091234995 11:134015674-134015696 CTGAGGTGGGCGCTGCAGTCTGG + Intergenic
1113363772 13:109656651-109656673 GAGAGCTAGGCGATCCGGTCAGG - Intergenic
1113660582 13:112104394-112104416 CCCCGCTGGGCGCTGCGGCCAGG + Intergenic
1114459663 14:22878374-22878396 GCCAGCTGGGCCCTGCGGTCAGG + Exonic
1118000440 14:61518144-61518166 CAGAGCAAGGCGCTATGGTCAGG + Intronic
1121821051 14:96966407-96966429 CCGAGCTGGGAGCTGGGCTCAGG - Intergenic
1122271183 14:100569030-100569052 TCTAGCTTGGCGCTGCGGCCGGG - Intronic
1122544905 14:102516964-102516986 CCGCGCTGGGCGCTGGGGTCGGG - Intergenic
1124075122 15:26436972-26436994 ACGAGCCAGGAGCTGCTGTCTGG - Intergenic
1124500857 15:30225456-30225478 CCGGGCTGGGCGCGGCGGCCCGG - Intergenic
1124742713 15:32313211-32313233 CCGGGCTGGGCGCGGCGGCCCGG + Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1134531997 16:14990252-14990274 CCGGGGTGGGCGCCGCGGTCTGG - Intronic
1135617988 16:23928582-23928604 CTGAGCTAGGAGCTGGGGTAAGG + Intronic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1142860423 17:2757504-2757526 TTGAGCCAGGCGCTGTGGTCGGG - Intergenic
1143512836 17:7405476-7405498 CCGGGTGAGGCGCTGCGGGCGGG + Intronic
1144686457 17:17229167-17229189 CAGAGCCAAGCGCTGCGGTCGGG + Intronic
1147183623 17:38702273-38702295 CGGAGCTGCGGGCTGCGGTCAGG - Intergenic
1147907465 17:43832657-43832679 CGGGGCTCGGCGCTGCGGGCTGG - Intronic
1160725515 19:616366-616388 CCGGGCTGGGCGCGGCGGCCCGG - Exonic
1160892712 19:1387707-1387729 CAGAGCTAGGCTGTGCGGGCAGG + Intronic
1162094776 19:8303860-8303882 CCGAGCTCGTCGCTGGAGTCGGG + Exonic
1163334504 19:16661780-16661802 CTGCGCTGGGGGCTGCGGTCAGG + Intronic
1163366229 19:16877534-16877556 CCGAGCCAGGTGCTGGGGACAGG - Exonic
1167557088 19:50203419-50203441 CGGAGCTAGGCGGCGCGGTCGGG - Intronic
1167741667 19:51327686-51327708 CCTGGCTGGGCGCTGCGGCCCGG + Intronic
925725451 2:6866261-6866283 CAGAGCTAGGAGTTGAGGTCGGG - Intronic
948393153 2:237627043-237627065 GAGAGCTAGGCTCTGGGGTCAGG - Intergenic
949010872 2:241677633-241677655 GAGAGGTAGGGGCTGCGGTCGGG + Intronic
1172005855 20:31818911-31818933 CAGAGCTAGGCACTAGGGTCAGG + Intergenic
1180960530 22:19760577-19760599 CCGAGCGAGCCGCGGCGGGCGGG + Intronic
1185345117 22:50307589-50307611 CCGCGCTCGGCGCTGCGCTCTGG + Exonic
991594371 5:68288011-68288033 ACGAGCGAGGCGCTGTGTTCTGG + Intronic
997710352 5:135998979-135999001 CCAATCTAGGGGCTGCGCTCAGG + Intergenic
1001549858 5:172594985-172595007 CCGGGCTGGGCACTGCGGGCAGG + Intergenic
1001855051 5:175003754-175003776 CCCAGCTAGGGGCTGCCCTCAGG + Intergenic
1003269287 6:4593137-4593159 CAGAGCCAGGCCCTGCGGTGGGG - Intergenic
1019994223 7:4713282-4713304 CCAAGCTAGGCTCTGGGGTTGGG + Intronic
1027765235 7:82332287-82332309 CCGAGGTGGGAGCTGAGGTCAGG - Intronic
1035265716 7:157689465-157689487 CTGAGCTGGGCGCTGCGGGCTGG - Intronic
1035688155 8:1540581-1540603 CCGGGCTGGGCGCTGGAGTCGGG + Intronic
1045510844 8:102810823-102810845 CCGACCTGGGCGCAGCGGGCGGG - Intergenic
1049657801 8:143806440-143806462 CCGAGGAAGGCCCTGCGGCCCGG - Exonic
1053312914 9:37030574-37030596 CTGTGCTAGGCGCTGGGGGCAGG + Intronic
1060821902 9:126666018-126666040 CCGAGCTAGGCGCTGTGCCGAGG + Intronic
1061164975 9:128916926-128916948 CCGGGCTGGGCTCTGCGGTGCGG + Exonic
1062525328 9:136975956-136975978 CAGAGCTGGGGGCTGCCGTCAGG - Intergenic
1062621156 9:137423165-137423187 CCGGGCCAGCGGCTGCGGTCGGG - Exonic