ID: 908258041

View in Genome Browser
Species Human (GRCh38)
Location 1:62318707-62318729
Sequence CCTAGCTCGGAAAAGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908258030_908258041 11 Left 908258030 1:62318673-62318695 CCCAGTCCCGCAGGCTGCATCCC 0: 1
1: 0
2: 0
3: 29
4: 198
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258027_908258041 27 Left 908258027 1:62318657-62318679 CCCGCGGCAAAGAACGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258031_908258041 10 Left 908258031 1:62318674-62318696 CCAGTCCCGCAGGCTGCATCCCA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258032_908258041 5 Left 908258032 1:62318679-62318701 CCCGCAGGCTGCATCCCAGACCG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258028_908258041 26 Left 908258028 1:62318658-62318680 CCGCGGCAAAGAACGCCCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258034_908258041 -9 Left 908258034 1:62318693-62318715 CCCAGACCGCAGCGCCTAGCTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258033_908258041 4 Left 908258033 1:62318680-62318702 CCGCAGGCTGCATCCCAGACCGC No data
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data
908258035_908258041 -10 Left 908258035 1:62318694-62318716 CCAGACCGCAGCGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908258041 Original CRISPR CCTAGCTCGGAAAAGCTGGG CGG Intronic
No off target data available for this crispr