ID: 908259296

View in Genome Browser
Species Human (GRCh38)
Location 1:62327311-62327333
Sequence CAGGAAGACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908259296_908259303 28 Left 908259296 1:62327311-62327333 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 908259303 1:62327362-62327384 TCTCTTGCTCTAGCTAAGCCCGG No data
908259296_908259305 30 Left 908259296 1:62327311-62327333 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 908259305 1:62327364-62327386 TCTTGCTCTAGCTAAGCCCGGGG No data
908259296_908259304 29 Left 908259296 1:62327311-62327333 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 908259304 1:62327363-62327385 CTCTTGCTCTAGCTAAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908259296 Original CRISPR CAGGAAGACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr