ID: 908260527

View in Genome Browser
Species Human (GRCh38)
Location 1:62336737-62336759
Sequence AGAACTGGACTTGGGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260527_908260538 8 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260538 1:62336768-62336790 AGGCTCCTCCCCTGGGAGCCTGG No data
908260527_908260532 0 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260532 1:62336760-62336782 CTTCCCCCAGGCTCCTCCCCTGG No data
908260527_908260539 11 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260527_908260546 27 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260546 1:62336787-62336809 CTGGAGGCCCCTACACCTGGAGG No data
908260527_908260533 1 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data
908260527_908260544 24 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260527 Original CRISPR AGAACTGGACTTGGGAAACA AGG (reversed) Intergenic
No off target data available for this crispr