ID: 908260529

View in Genome Browser
Species Human (GRCh38)
Location 1:62336746-62336768
Sequence TGGGGGAAGAGAACTGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260529_908260538 -1 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260538 1:62336768-62336790 AGGCTCCTCCCCTGGGAGCCTGG No data
908260529_908260532 -9 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260532 1:62336760-62336782 CTTCCCCCAGGCTCCTCCCCTGG No data
908260529_908260549 25 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260529_908260539 2 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260529_908260544 15 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260529_908260547 24 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG No data
908260529_908260546 18 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260546 1:62336787-62336809 CTGGAGGCCCCTACACCTGGAGG No data
908260529_908260533 -8 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260529 Original CRISPR TGGGGGAAGAGAACTGGACT TGG (reversed) Intergenic
No off target data available for this crispr