ID: 908260531

View in Genome Browser
Species Human (GRCh38)
Location 1:62336752-62336774
Sequence GGAGCCTGGGGGAAGAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260531_908260544 9 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260531_908260549 19 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260531_908260538 -7 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260538 1:62336768-62336790 AGGCTCCTCCCCTGGGAGCCTGG No data
908260531_908260546 12 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260546 1:62336787-62336809 CTGGAGGCCCCTACACCTGGAGG No data
908260531_908260554 29 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260531_908260547 18 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG No data
908260531_908260539 -4 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260531_908260552 25 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260531 Original CRISPR GGAGCCTGGGGGAAGAGAAC TGG (reversed) Intergenic
No off target data available for this crispr