ID: 908260533

View in Genome Browser
Species Human (GRCh38)
Location 1:62336761-62336783
Sequence TTCCCCCAGGCTCCTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260527_908260533 1 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data
908260528_908260533 -7 Left 908260528 1:62336745-62336767 CCCAAGTCCAGTTCTCTTCCCCC No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data
908260529_908260533 -8 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data
908260526_908260533 8 Left 908260526 1:62336730-62336752 CCAGCGTCCTTGTTTCCCAAGTC No data
Right 908260533 1:62336761-62336783 TTCCCCCAGGCTCCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260533 Original CRISPR TTCCCCCAGGCTCCTCCCCT GGG Intergenic
No off target data available for this crispr