ID: 908260536

View in Genome Browser
Species Human (GRCh38)
Location 1:62336765-62336787
Sequence GGCTCCCAGGGGAGGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260536_908260555 20 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260536_908260546 -1 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260546 1:62336787-62336809 CTGGAGGCCCCTACACCTGGAGG No data
908260536_908260549 6 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260536_908260552 12 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG No data
908260536_908260554 16 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260536_908260547 5 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG No data
908260536_908260544 -4 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260536 Original CRISPR GGCTCCCAGGGGAGGAGCCT GGG (reversed) Intergenic