ID: 908260537

View in Genome Browser
Species Human (GRCh38)
Location 1:62336766-62336788
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260537_908260554 15 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260537_908260544 -5 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260537_908260552 11 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG No data
908260537_908260555 19 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260537_908260549 5 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260537_908260546 -2 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260546 1:62336787-62336809 CTGGAGGCCCCTACACCTGGAGG No data
908260537_908260547 4 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260537 Original CRISPR AGGCTCCCAGGGGAGGAGCC TGG (reversed) Intergenic