ID: 908260539

View in Genome Browser
Species Human (GRCh38)
Location 1:62336771-62336793
Sequence CTCCTCCCCTGGGAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260531_908260539 -4 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260527_908260539 11 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260526_908260539 18 Left 908260526 1:62336730-62336752 CCAGCGTCCTTGTTTCCCAAGTC No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260529_908260539 2 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data
908260528_908260539 3 Left 908260528 1:62336745-62336767 CCCAAGTCCAGTTCTCTTCCCCC No data
Right 908260539 1:62336771-62336793 CTCCTCCCCTGGGAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260539 Original CRISPR CTCCTCCCCTGGGAGCCTGG AGG Intergenic
No off target data available for this crispr