ID: 908260541

View in Genome Browser
Species Human (GRCh38)
Location 1:62336776-62336798
Sequence AGGGGCCTCCAGGCTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260541_908260559 27 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data
908260541_908260554 5 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260541_908260549 -5 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260541_908260547 -6 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260547 1:62336793-62336815 GCCCCTACACCTGGAGGAGCCGG No data
908260541_908260555 9 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260541_908260552 1 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG No data
908260541_908260558 26 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260541 Original CRISPR AGGGGCCTCCAGGCTCCCAG GGG (reversed) Intergenic
No off target data available for this crispr