ID: 908260544

View in Genome Browser
Species Human (GRCh38)
Location 1:62336784-62336806
Sequence AGCCTGGAGGCCCCTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260535_908260544 -3 Left 908260535 1:62336764-62336786 CCCCAGGCTCCTCCCCTGGGAGC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260537_908260544 -5 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260534_908260544 -2 Left 908260534 1:62336763-62336785 CCCCCAGGCTCCTCCCCTGGGAG No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260536_908260544 -4 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260527_908260544 24 Left 908260527 1:62336737-62336759 CCTTGTTTCCCAAGTCCAGTTCT No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260531_908260544 9 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260529_908260544 15 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data
908260528_908260544 16 Left 908260528 1:62336745-62336767 CCCAAGTCCAGTTCTCTTCCCCC No data
Right 908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260544 Original CRISPR AGCCTGGAGGCCCCTACACC TGG Intergenic
No off target data available for this crispr