ID: 908260545

View in Genome Browser
Species Human (GRCh38)
Location 1:62336786-62336808
Sequence CTCCAGGTGTAGGGGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260545_908260562 30 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260545_908260555 -1 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260545_908260559 17 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data
908260545_908260554 -5 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260545_908260558 16 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260545_908260552 -9 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260545 Original CRISPR CTCCAGGTGTAGGGGCCTCC AGG (reversed) Intergenic