ID: 908260548

View in Genome Browser
Species Human (GRCh38)
Location 1:62336794-62336816
Sequence CCCGGCTCCTCCAGGTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260548_908260562 22 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260548_908260558 8 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260548_908260567 30 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data
908260548_908260555 -9 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260548_908260563 23 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260548_908260566 29 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260548_908260559 9 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data
908260548_908260565 26 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260548 Original CRISPR CCCGGCTCCTCCAGGTGTAG GGG (reversed) Intergenic