ID: 908260549

View in Genome Browser
Species Human (GRCh38)
Location 1:62336794-62336816
Sequence CCCCTACACCTGGAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260529_908260549 25 Left 908260529 1:62336746-62336768 CCAAGTCCAGTTCTCTTCCCCCA No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260537_908260549 5 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260536_908260549 6 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260531_908260549 19 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260541_908260549 -5 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260540_908260549 -2 Left 908260540 1:62336773-62336795 CCTCCCCTGGGAGCCTGGAGGCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260543_908260549 -7 Left 908260543 1:62336778-62336800 CCTGGGAGCCTGGAGGCCCCTAC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260534_908260549 8 Left 908260534 1:62336763-62336785 CCCCCAGGCTCCTCCCCTGGGAG No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260542_908260549 -6 Left 908260542 1:62336777-62336799 CCCTGGGAGCCTGGAGGCCCCTA No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260528_908260549 26 Left 908260528 1:62336745-62336767 CCCAAGTCCAGTTCTCTTCCCCC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
908260535_908260549 7 Left 908260535 1:62336764-62336786 CCCCAGGCTCCTCCCCTGGGAGC No data
Right 908260549 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260549 Original CRISPR CCCCTACACCTGGAGGAGCC GGG Intergenic
No off target data available for this crispr