ID: 908260550

View in Genome Browser
Species Human (GRCh38)
Location 1:62336795-62336817
Sequence GCCCGGCTCCTCCAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260550_908260565 25 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260550_908260558 7 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260550_908260567 29 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data
908260550_908260555 -10 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260550_908260566 28 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260550_908260562 21 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260550_908260563 22 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260550_908260559 8 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260550 Original CRISPR GCCCGGCTCCTCCAGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr