ID: 908260551

View in Genome Browser
Species Human (GRCh38)
Location 1:62336796-62336818
Sequence GGCCCGGCTCCTCCAGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260551_908260559 7 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data
908260551_908260558 6 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260551_908260567 28 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data
908260551_908260566 27 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260551_908260562 20 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260551_908260563 21 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260551_908260565 24 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260551 Original CRISPR GGCCCGGCTCCTCCAGGTGT AGG (reversed) Intergenic