ID: 908260553

View in Genome Browser
Species Human (GRCh38)
Location 1:62336802-62336824
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260553_908260563 15 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260553_908260562 14 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260553_908260566 21 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260553_908260565 18 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260553_908260567 22 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data
908260553_908260568 28 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260553_908260558 0 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260553_908260559 1 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260553 Original CRISPR AACCTTGGCCCGGCTCCTCC AGG (reversed) Intergenic