ID: 908260554

View in Genome Browser
Species Human (GRCh38)
Location 1:62336804-62336826
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260542_908260554 4 Left 908260542 1:62336777-62336799 CCCTGGGAGCCTGGAGGCCCCTA No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260540_908260554 8 Left 908260540 1:62336773-62336795 CCTCCCCTGGGAGCCTGGAGGCC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260537_908260554 15 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260541_908260554 5 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260536_908260554 16 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260535_908260554 17 Left 908260535 1:62336764-62336786 CCCCAGGCTCCTCCCCTGGGAGC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260545_908260554 -5 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260534_908260554 18 Left 908260534 1:62336763-62336785 CCCCCAGGCTCCTCCCCTGGGAG No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260531_908260554 29 Left 908260531 1:62336752-62336774 CCAGTTCTCTTCCCCCAGGCTCC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data
908260543_908260554 3 Left 908260543 1:62336778-62336800 CCTGGGAGCCTGGAGGCCCCTAC No data
Right 908260554 1:62336804-62336826 TGGAGGAGCCGGGCCAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type