ID: 908260555

View in Genome Browser
Species Human (GRCh38)
Location 1:62336808-62336830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260548_908260555 -9 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260550_908260555 -10 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260535_908260555 21 Left 908260535 1:62336764-62336786 CCCCAGGCTCCTCCCCTGGGAGC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260542_908260555 8 Left 908260542 1:62336777-62336799 CCCTGGGAGCCTGGAGGCCCCTA No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260536_908260555 20 Left 908260536 1:62336765-62336787 CCCAGGCTCCTCCCCTGGGAGCC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260534_908260555 22 Left 908260534 1:62336763-62336785 CCCCCAGGCTCCTCCCCTGGGAG No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260541_908260555 9 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260540_908260555 12 Left 908260540 1:62336773-62336795 CCTCCCCTGGGAGCCTGGAGGCC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260537_908260555 19 Left 908260537 1:62336766-62336788 CCAGGCTCCTCCCCTGGGAGCCT No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260543_908260555 7 Left 908260543 1:62336778-62336800 CCTGGGAGCCTGGAGGCCCCTAC No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data
908260545_908260555 -1 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type