ID: 908260556

View in Genome Browser
Species Human (GRCh38)
Location 1:62336812-62336834
Sequence GCAGCCATCCAACCTTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260556_908260571 28 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260556_908260558 -10 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260556_908260567 12 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data
908260556_908260559 -9 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260559 1:62336826-62336848 GATGGCTGCCTGCCTGCCGAGGG No data
908260556_908260565 8 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260556_908260568 18 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260556_908260569 24 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260556_908260563 5 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260556_908260562 4 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260556_908260566 11 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260556_908260570 25 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260556 Original CRISPR GCAGCCATCCAACCTTGGCC CGG (reversed) Intergenic