ID: 908260557

View in Genome Browser
Species Human (GRCh38)
Location 1:62336817-62336839
Sequence GGCAGGCAGCCATCCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260557_908260570 20 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data
908260557_908260571 23 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260557_908260563 0 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260563 1:62336840-62336862 TGCCGAGGGCACTGTAGAGCGGG No data
908260557_908260569 19 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260557_908260562 -1 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260557_908260565 3 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260557_908260566 6 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG No data
908260557_908260568 13 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260557_908260567 7 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260557 Original CRISPR GGCAGGCAGCCATCCAACCT TGG (reversed) Intergenic