ID: 908260558

View in Genome Browser
Species Human (GRCh38)
Location 1:62336825-62336847
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260548_908260558 8 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260551_908260558 6 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260556_908260558 -10 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260543_908260558 24 Left 908260543 1:62336778-62336800 CCTGGGAGCCTGGAGGCCCCTAC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260545_908260558 16 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260541_908260558 26 Left 908260541 1:62336776-62336798 CCCCTGGGAGCCTGGAGGCCCCT No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260542_908260558 25 Left 908260542 1:62336777-62336799 CCCTGGGAGCCTGGAGGCCCCTA No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260550_908260558 7 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260553_908260558 0 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data
908260540_908260558 29 Left 908260540 1:62336773-62336795 CCTCCCCTGGGAGCCTGGAGGCC No data
Right 908260558 1:62336825-62336847 GGATGGCTGCCTGCCTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type