ID: 908260562

View in Genome Browser
Species Human (GRCh38)
Location 1:62336839-62336861
Sequence CTGCCGAGGGCACTGTAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260548_908260562 22 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260550_908260562 21 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260545_908260562 30 Left 908260545 1:62336786-62336808 CCTGGAGGCCCCTACACCTGGAG No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260553_908260562 14 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260557_908260562 -1 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260551_908260562 20 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data
908260556_908260562 4 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260562 1:62336839-62336861 CTGCCGAGGGCACTGTAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260562 Original CRISPR CTGCCGAGGGCACTGTAGAG CGG Intergenic
No off target data available for this crispr