ID: 908260565

View in Genome Browser
Species Human (GRCh38)
Location 1:62336843-62336865
Sequence CGAGGGCACTGTAGAGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260548_908260565 26 Left 908260548 1:62336794-62336816 CCCCTACACCTGGAGGAGCCGGG No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260550_908260565 25 Left 908260550 1:62336795-62336817 CCCTACACCTGGAGGAGCCGGGC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260556_908260565 8 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260551_908260565 24 Left 908260551 1:62336796-62336818 CCTACACCTGGAGGAGCCGGGCC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260557_908260565 3 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data
908260553_908260565 18 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260565 Original CRISPR CGAGGGCACTGTAGAGCGGG TGG Intergenic