ID: 908260568

View in Genome Browser
Species Human (GRCh38)
Location 1:62336853-62336875
Sequence GTAGAGCGGGTGGTGGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260561_908260568 -8 Left 908260561 1:62336838-62336860 CCTGCCGAGGGCACTGTAGAGCG No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260557_908260568 13 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260556_908260568 18 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260560_908260568 -4 Left 908260560 1:62336834-62336856 CCTGCCTGCCGAGGGCACTGTAG No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data
908260553_908260568 28 Left 908260553 1:62336802-62336824 CCTGGAGGAGCCGGGCCAAGGTT No data
Right 908260568 1:62336853-62336875 GTAGAGCGGGTGGTGGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260568 Original CRISPR GTAGAGCGGGTGGTGGGTAG TGG Intergenic