ID: 908260569

View in Genome Browser
Species Human (GRCh38)
Location 1:62336859-62336881
Sequence CGGGTGGTGGGTAGTGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260564_908260569 -6 Left 908260564 1:62336842-62336864 CCGAGGGCACTGTAGAGCGGGTG No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260556_908260569 24 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260557_908260569 19 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260561_908260569 -2 Left 908260561 1:62336838-62336860 CCTGCCGAGGGCACTGTAGAGCG No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data
908260560_908260569 2 Left 908260560 1:62336834-62336856 CCTGCCTGCCGAGGGCACTGTAG No data
Right 908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260569 Original CRISPR CGGGTGGTGGGTAGTGGATG AGG Intergenic