ID: 908260570

View in Genome Browser
Species Human (GRCh38)
Location 1:62336860-62336882
Sequence GGGTGGTGGGTAGTGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260564_908260570 -5 Left 908260564 1:62336842-62336864 CCGAGGGCACTGTAGAGCGGGTG No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data
908260556_908260570 25 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data
908260557_908260570 20 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data
908260560_908260570 3 Left 908260560 1:62336834-62336856 CCTGCCTGCCGAGGGCACTGTAG No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data
908260561_908260570 -1 Left 908260561 1:62336838-62336860 CCTGCCGAGGGCACTGTAGAGCG No data
Right 908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260570 Original CRISPR GGGTGGTGGGTAGTGGATGA GGG Intergenic