ID: 908260571

View in Genome Browser
Species Human (GRCh38)
Location 1:62336863-62336885
Sequence TGGTGGGTAGTGGATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908260564_908260571 -2 Left 908260564 1:62336842-62336864 CCGAGGGCACTGTAGAGCGGGTG No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260560_908260571 6 Left 908260560 1:62336834-62336856 CCTGCCTGCCGAGGGCACTGTAG No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260561_908260571 2 Left 908260561 1:62336838-62336860 CCTGCCGAGGGCACTGTAGAGCG No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260556_908260571 28 Left 908260556 1:62336812-62336834 CCGGGCCAAGGTTGGATGGCTGC No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data
908260557_908260571 23 Left 908260557 1:62336817-62336839 CCAAGGTTGGATGGCTGCCTGCC No data
Right 908260571 1:62336863-62336885 TGGTGGGTAGTGGATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908260571 Original CRISPR TGGTGGGTAGTGGATGAGGG TGG Intergenic