ID: 908263112

View in Genome Browser
Species Human (GRCh38)
Location 1:62353924-62353946
Sequence CTGTATTTCCAGCTGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908263112_908263115 -2 Left 908263112 1:62353924-62353946 CCCAGTTTCAGCTGGAAATACAG No data
Right 908263115 1:62353945-62353967 AGATCTGAAGCTGAGGAGAGTGG No data
908263112_908263118 22 Left 908263112 1:62353924-62353946 CCCAGTTTCAGCTGGAAATACAG No data
Right 908263118 1:62353969-62353991 GTTGAGAGTCCTCAGGGTGTAGG No data
908263112_908263116 15 Left 908263112 1:62353924-62353946 CCCAGTTTCAGCTGGAAATACAG No data
Right 908263116 1:62353962-62353984 GAGTGGAGTTGAGAGTCCTCAGG No data
908263112_908263117 16 Left 908263112 1:62353924-62353946 CCCAGTTTCAGCTGGAAATACAG No data
Right 908263117 1:62353963-62353985 AGTGGAGTTGAGAGTCCTCAGGG No data
908263112_908263114 -9 Left 908263112 1:62353924-62353946 CCCAGTTTCAGCTGGAAATACAG No data
Right 908263114 1:62353938-62353960 GAAATACAGATCTGAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908263112 Original CRISPR CTGTATTTCCAGCTGAAACT GGG (reversed) Intergenic
No off target data available for this crispr