ID: 908263766

View in Genome Browser
Species Human (GRCh38)
Location 1:62359085-62359107
Sequence GATCTAAGCAAGTCACCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908263762_908263766 11 Left 908263762 1:62359051-62359073 CCTCTGCTCGTGTCACACATGCT No data
Right 908263766 1:62359085-62359107 GATCTAAGCAAGTCACCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908263766 Original CRISPR GATCTAAGCAAGTCACCCGC AGG Intergenic
No off target data available for this crispr