ID: 908265882

View in Genome Browser
Species Human (GRCh38)
Location 1:62378762-62378784
Sequence CTAACTCATCTCTAAAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908265882_908265887 -7 Left 908265882 1:62378762-62378784 CCCAAATTTTAGAGATGAGTTAG No data
Right 908265887 1:62378778-62378800 GAGTTAGTTGGGGCTTATTGAGG No data
908265882_908265889 16 Left 908265882 1:62378762-62378784 CCCAAATTTTAGAGATGAGTTAG No data
Right 908265889 1:62378801-62378823 TTATGTAACCTACTAAGTAAGGG No data
908265882_908265888 15 Left 908265882 1:62378762-62378784 CCCAAATTTTAGAGATGAGTTAG No data
Right 908265888 1:62378800-62378822 GTTATGTAACCTACTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908265882 Original CRISPR CTAACTCATCTCTAAAATTT GGG (reversed) Intergenic
No off target data available for this crispr