ID: 908265882 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:62378762-62378784 |
| Sequence | CTAACTCATCTCTAAAATTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908265882_908265889 | 16 | Left | 908265882 | 1:62378762-62378784 | CCCAAATTTTAGAGATGAGTTAG | No data | ||
| Right | 908265889 | 1:62378801-62378823 | TTATGTAACCTACTAAGTAAGGG | No data | ||||
| 908265882_908265887 | -7 | Left | 908265882 | 1:62378762-62378784 | CCCAAATTTTAGAGATGAGTTAG | No data | ||
| Right | 908265887 | 1:62378778-62378800 | GAGTTAGTTGGGGCTTATTGAGG | No data | ||||
| 908265882_908265888 | 15 | Left | 908265882 | 1:62378762-62378784 | CCCAAATTTTAGAGATGAGTTAG | No data | ||
| Right | 908265888 | 1:62378800-62378822 | GTTATGTAACCTACTAAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908265882 | Original CRISPR | CTAACTCATCTCTAAAATTT GGG (reversed) | Intergenic | ||