ID: 908265883

View in Genome Browser
Species Human (GRCh38)
Location 1:62378763-62378785
Sequence ACTAACTCATCTCTAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908265883_908265887 -8 Left 908265883 1:62378763-62378785 CCAAATTTTAGAGATGAGTTAGT No data
Right 908265887 1:62378778-62378800 GAGTTAGTTGGGGCTTATTGAGG No data
908265883_908265888 14 Left 908265883 1:62378763-62378785 CCAAATTTTAGAGATGAGTTAGT No data
Right 908265888 1:62378800-62378822 GTTATGTAACCTACTAAGTAAGG No data
908265883_908265889 15 Left 908265883 1:62378763-62378785 CCAAATTTTAGAGATGAGTTAGT No data
Right 908265889 1:62378801-62378823 TTATGTAACCTACTAAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908265883 Original CRISPR ACTAACTCATCTCTAAAATT TGG (reversed) Intergenic