ID: 908265887

View in Genome Browser
Species Human (GRCh38)
Location 1:62378778-62378800
Sequence GAGTTAGTTGGGGCTTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908265883_908265887 -8 Left 908265883 1:62378763-62378785 CCAAATTTTAGAGATGAGTTAGT No data
Right 908265887 1:62378778-62378800 GAGTTAGTTGGGGCTTATTGAGG No data
908265882_908265887 -7 Left 908265882 1:62378762-62378784 CCCAAATTTTAGAGATGAGTTAG No data
Right 908265887 1:62378778-62378800 GAGTTAGTTGGGGCTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908265887 Original CRISPR GAGTTAGTTGGGGCTTATTG AGG Intergenic
No off target data available for this crispr