ID: 908265888

View in Genome Browser
Species Human (GRCh38)
Location 1:62378800-62378822
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908265883_908265888 14 Left 908265883 1:62378763-62378785 CCAAATTTTAGAGATGAGTTAGT No data
Right 908265888 1:62378800-62378822 GTTATGTAACCTACTAAGTAAGG No data
908265882_908265888 15 Left 908265882 1:62378762-62378784 CCCAAATTTTAGAGATGAGTTAG No data
Right 908265888 1:62378800-62378822 GTTATGTAACCTACTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type