ID: 908267543

View in Genome Browser
Species Human (GRCh38)
Location 1:62394145-62394167
Sequence CCTGGGAAGCAGCAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908267543_908267552 12 Left 908267543 1:62394145-62394167 CCCTCCTCTTGCTGCTTCCCAGG No data
Right 908267552 1:62394180-62394202 TCATCTCTTGCCTGGATTACTGG No data
908267543_908267550 4 Left 908267543 1:62394145-62394167 CCCTCCTCTTGCTGCTTCCCAGG No data
Right 908267550 1:62394172-62394194 AGCCTTTCTCATCTCTTGCCTGG No data
908267543_908267553 15 Left 908267543 1:62394145-62394167 CCCTCCTCTTGCTGCTTCCCAGG No data
Right 908267553 1:62394183-62394205 TCTCTTGCCTGGATTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908267543 Original CRISPR CCTGGGAAGCAGCAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr