ID: 908269011

View in Genome Browser
Species Human (GRCh38)
Location 1:62404866-62404888
Sequence CACCCTGGGCTGCCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908269005_908269011 9 Left 908269005 1:62404834-62404856 CCCCAAGGGCTCTGAAACAGAGC No data
Right 908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG No data
908269007_908269011 7 Left 908269007 1:62404836-62404858 CCAAGGGCTCTGAAACAGAGCCA No data
Right 908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG No data
908269004_908269011 16 Left 908269004 1:62404827-62404849 CCTAGGTCCCCAAGGGCTCTGAA No data
Right 908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG No data
908269006_908269011 8 Left 908269006 1:62404835-62404857 CCCAAGGGCTCTGAAACAGAGCC No data
Right 908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908269011 Original CRISPR CACCCTGGGCTGCCTCTCAC AGG Intergenic
No off target data available for this crispr