ID: 908271426

View in Genome Browser
Species Human (GRCh38)
Location 1:62426397-62426419
Sequence TAAGTGGGCGGGTGCTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908271426_908271441 30 Left 908271426 1:62426397-62426419 CCCCCTCAGCACCCGCCCACTTA No data
Right 908271441 1:62426450-62426472 ACATTAAGGAAGGTGCGGCAAGG No data
908271426_908271438 20 Left 908271426 1:62426397-62426419 CCCCCTCAGCACCCGCCCACTTA No data
Right 908271438 1:62426440-62426462 TTGTTACCAAACATTAAGGAAGG No data
908271426_908271437 16 Left 908271426 1:62426397-62426419 CCCCCTCAGCACCCGCCCACTTA No data
Right 908271437 1:62426436-62426458 TAAATTGTTACCAAACATTAAGG No data
908271426_908271439 25 Left 908271426 1:62426397-62426419 CCCCCTCAGCACCCGCCCACTTA No data
Right 908271439 1:62426445-62426467 ACCAAACATTAAGGAAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908271426 Original CRISPR TAAGTGGGCGGGTGCTGAGG GGG (reversed) Intergenic
No off target data available for this crispr