ID: 908272016

View in Genome Browser
Species Human (GRCh38)
Location 1:62431397-62431419
Sequence GGTGAAGCATAGTCAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908272016_908272021 24 Left 908272016 1:62431397-62431419 CCAGGAGCTGACTATGCTTCACC No data
Right 908272021 1:62431444-62431466 TTCAGCTCCCAAACCTCATCTGG No data
908272016_908272017 -9 Left 908272016 1:62431397-62431419 CCAGGAGCTGACTATGCTTCACC No data
Right 908272017 1:62431411-62431433 TGCTTCACCTACCACCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908272016 Original CRISPR GGTGAAGCATAGTCAGCTCC TGG (reversed) Intergenic
No off target data available for this crispr