ID: 908294305

View in Genome Browser
Species Human (GRCh38)
Location 1:62698016-62698038
Sequence CTCTTGAAACAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908294294_908294305 26 Left 908294294 1:62697967-62697989 CCAAGAAATACGGAGAACCAAAT No data
Right 908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG No data
908294299_908294305 9 Left 908294299 1:62697984-62698006 CCAAATGGGGAAGGTGCTGAAAG No data
Right 908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908294305 Original CRISPR CTCTTGAAACAGAGGGAGCA GGG Intergenic
No off target data available for this crispr