ID: 908299213

View in Genome Browser
Species Human (GRCh38)
Location 1:62745435-62745457
Sequence GGAAGAACAGACTCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908299213_908299218 0 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299218 1:62745458-62745480 TCTCTCAACTGGCCTAGGATGGG No data
908299213_908299215 -5 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299215 1:62745453-62745475 CTTCCTCTCTCAACTGGCCTAGG No data
908299213_908299222 30 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299222 1:62745488-62745510 TGTAGAGCACAGGCATATTTAGG No data
908299213_908299219 4 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299219 1:62745462-62745484 TCAACTGGCCTAGGATGGGATGG No data
908299213_908299221 20 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299221 1:62745478-62745500 GGGATGGAACTGTAGAGCACAGG No data
908299213_908299217 -1 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299217 1:62745457-62745479 CTCTCTCAACTGGCCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908299213 Original CRISPR GGAAGAACAGACTCTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr