ID: 908299215

View in Genome Browser
Species Human (GRCh38)
Location 1:62745453-62745475
Sequence CTTCCTCTCTCAACTGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908299213_908299215 -5 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299215 1:62745453-62745475 CTTCCTCTCTCAACTGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908299215 Original CRISPR CTTCCTCTCTCAACTGGCCT AGG Intergenic
No off target data available for this crispr